1
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Which of the following statement is correct regarding the process of replication in E.coli?
2
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Match List I with List II
List - I | List - II | ||
---|---|---|---|
A. | Frederick Griffith | I. | Genetic code |
B. | Francois Jacob & Jacque Monod | II. | Semi-conservative mode of DNA replication |
C. | Har Gobind Khorana | III. | Tranformation |
D. | Meselson & Stahl | IV. | Lac operon |
Choose the correct answer from the options given below:
3
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Match List I with List II :
List - I | List - II | ||
---|---|---|---|
A. | Down's syndrome | I. | 11$$^\mathrm{th}$$ chromosome |
B. | $$\alpha$$-thalassemia | II. | 'X' chromosome |
C. | $$\beta$$-thalassemia | III. | 21$$^\mathrm{st}$$ chromosome |
D. | Klinefelter's syndrome | IV. | 16$$^\mathrm{th}$$ chromosome |
Choose the correct answer from the options given below :
4
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
Questions Asked from Molecular Basis of Inheritance (MCQ (Single Correct Answer))
Number in Brackets after Paper Indicates No. of Questions
NEET 2024 (Re-Examination) (4)
NEET 2024 (7)
NEET 2023 Manipur (9)
NEET 2023 (7)
NEET 2022 Phase 2 (6)
NEET 2022 Phase 1 (8)
NEET 2021 (10)
NEET 2020 Phase 1 (4)
NEET 2019 (6)
NEET 2018 (7)
NEET 2017 (6)
NEET 2016 Phase 2 (5)
NEET 2016 Phase 1 (3)
AIPMT 2015 (4)
AIPMT 2015 Cancelled Paper (2)
AIPMT 2014 (2)
NEET 2013 (Karnataka) (6)
NEET 2013 (3)
AIPMT 2012 Prelims (5)
AIPMT 2011 Mains (1)
AIPMT 2011 Prelims (1)
AIPMT 2010 Mains (4)
AIPMT 2010 Prelims (4)
AIPMT 2009 (4)
AIPMT 2008 (4)
AIPMT 2006 (5)
AIPMT 2005 (7)
AIPMT 2004 (5)
AIPMT 2003 (7)
AIPMT 2002 (9)
AIPMT 2001 (4)
AIPMT 2000 (6)
NEET Subjects
Physics
Mechanics
Units & Measurement Motion in a Straight Line Motion in a Plane Laws of Motion Work, Energy and Power Center of Mass and Collision Rotational Motion Gravitation Properties of Matter Heat and Thermodynamics Oscillations Waves
Electricity
Electrostatics Current Electricity Capacitor Moving Charges and Magnetism Magnetism and Matter Electromagnetic Induction Alternating Current Electromagnetic Waves
Optics
Modern Physics
Chemistry
Physical Chemistry
Some Basic Concepts of Chemistry Structure of Atom Redox Reactions Gaseous State Chemical Equilibrium Ionic Equilibrium Solutions Thermodynamics Electrochemistry Chemical Kinetics Nuclear Chemistry Solid State Surface Chemistry
Inorganic Chemistry
Periodic Table and Periodicity Chemical Bonding and Molecular Structure Processes of Isolation of Elements s-Block Elements Hydrogen p-Block Elements d and f Block Elements Coordination Compounds Environmental Chemistry
Organic Chemistry
Biology
Botany
Cell - The Unit of Life Biomolecules Cell Cycle and Cell Division Sexual Reproduction in Flowering Plants Microbes in Human Welfare Anatomy of Flowering Plants Transport in Plants Mineral Nutrition Respiration in Plants Biotechnology: Principles and Processes Biodiversity and Conservation The Living World Biological Classification Morphology of Flowering Plants Photosynthesis in Higher Plants Principles of Inheritance and Variation Molecular Basis of Inheritance Strategies for Enhancement in Food Production Biotechnology and It's Applications Organisms and Populations Environmental Issues Plant Kingdom Plant Growth and Development Ecosystem
Zoology
Human Health and Diseases Body Fluids and Its Circulation Locomotion and Movement Neural Control and Coordination Reproduction in Organisms Reproductive Health Structural Organisation in Animals Digestion and Absorption Excretory Products and Their Elimination Chemical Coordination and Integration Human Reproduction Animal Kingdom Breathing and Exchange of Gases Evolution