Molecular Basis of Inheritance · Biology · NEET

Which chromosome in the human genome has the highest number of genes?

Match List-I with List-II

Choose the correct answer from the options given below:

Which of the following are the post-transcriptional events in an eukaryotic cell?

A. Transport of pre-mRNA to cytoplasm prior to splicing.

B. Removal of introns and joining of exons.

C. Addition of methyl group at 5' end of hnRNA.

D. Addition of adenine residues at 3' end of hnRNA.

E. Base pairing of two complementary RNAs.

Choose the correct answer from the options given below :

Given below are two statements:

Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable.

Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism.

In the light of the above statements, choose the most appropriate answer from the options given below :

Given below are two statements :

Statement 1 : Transfer RNAs and ribosomal RNA do not interact with mRNA.

Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.

In the light of the above statements, choose the most appropriate answer from the options given below :

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Which factor is important for termination of transcription?

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

Given below are two statements regarding RNA polymerase in prokaryotes.

Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription.

Statement II : RNA polymerase associate transiently with ‘Rho’ factor to initiate transcription.

In the light of the above statements, choose the correct answer from the options given below :

Given below are two statements:

Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles.

Statement II: All the three RNA polymerases in eukaryotic nucleus have different roles.

In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements :

Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense.

Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA molecule that binds and prevents translation of mRNA

In the light of the above statements, choose the correct answer from the options given below.

The lactose present in the growth medium of bacteria is transported to the cell by the action of

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

Which of the following statement is correct regarding the process of replication in E.coli?

Match List I with List II

Choose the correct answer from the options given below:

Match List I with List II :

Choose the correct answer from the options given below :

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3'TACATGGCAAATATCCATTCA5'

Match List I with List II:

Choose the correct answer from the options given below :

The last chromosome sequenced in Human Genome Project was:

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

Given below are two statements :

Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcription.

Statement II : A transcription unit in DNA is defined primarily by the three regions in the DNA i.e., a promotor, the structural gene and a terminator.

In the light of the above statements, choose the correct answer from the options given below :

Which scientist conducted an experiment with ³²P and ³⁵S labelled phages for demonstrating that DNA is the genetic material?

Given below are two statements :

Statement I : RNA being unstable, mutate at a faster rate.

Statement II : RNA can directly code for synthesis of proteins hence can easily express the characters.

In the light of the above statements, choose the correct answer from the options given below :

Select the correct statements about sickle cell anaemia.

(A) There is a change in gene for beta globin.

(B) In the beta globin, there is valine in the place of Lysine.

(C) It is an example of point mutation.

(D) In the normal gene U is replaced by A.

Choose the correct answer from the options given below :

Which one of the following acts as an inducer for lac operon ?

With reference to Hershey and Chase experiments. Select the correct statements.

(A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA.

(B) Viruses grown on radioactive sulphur contained radioactive proteins.

(C) Viruses grown on radioactive phosphorus contained radioactive protein.

(D) Viruses grown on radioactive sulphur contained radioactive DNA.

(E) Viruses grown on radioactive protein contained radioactive DNA.

Choose the most appropriate answer from the options given below :

The salient features of genetic code are :

(A) The code is palindromic

(B) UGA act as initiator codon

(C) The code is unambiguous and specific

(D) The code is nearly universal

Choose the most appropriate answer from the options given below :

Unequivocal proof that DNA is the genetic material was first proposed by

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Expressed Sequence Tags (ESTs) refers to

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Match List I with List II.

Choose the correct answer from the options given below :

Given below are two statements:

Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.

Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

In the light of the above statements, choose the correct answer from the options given below:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

In lac operon, z gene codes for

Given below are two statements

Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'.

Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is discontinuous.

In the light of the above statements, choose the correct answer from the options given below:

Match List - I with List - II.

Choose the correct answer from the options given below

Match List-I with List-II:

Choose the correct answer from the options given below:

Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?

If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?

The process of translation of mRNA to proteins begins as soon as:

DNA polymorphism forms the basis of:

Read the following statements and choose the set of correct statements:

(a) Euchromatin is loosely packed chromatin

(b) Heterochromatin is transcriptionally active

(c) Histone octamer is wrapped by negatively charged DNA in nucleosome

(d) Histones are rich in lysine and arginine

(e) A typical nucleosome contains 400 bp of DNA helix

Choose the correct answer from the options given below :

Transposons can be used during which one of the following?

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :

If the length of a DNA molecule is 1.1 metres, what will b the approximate number of base pairs?

In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

Ten E.coli cells with ¹⁵N - dsDNA are incubated in medium containing ¹⁴N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from ¹⁵N?