Molecular Basis of Inheritance · Biology · NEET

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the proc...

Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in t...

Given below are two statements : Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense. Statement II : ...

The lactose present in the growth medium of bacteria is transported to the cell by the action of

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

Which of the following statement is correct regarding the process of replication in E.coli?

Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:solid;border-width:1px;font-family...

Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:solid;border-width:1px;font-fami...

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:solid;border-width:1px;font-famil...

The last chromosome sequenced in Human Genome Project was:

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

Given below are two statements : Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcript...

Which scientist conducted an experiment with 32P and 35S labelled phages for demonstrating that DNA is the genetic material? ...

Given below are two statements : Statement I : RNA being unstable, mutate at a faster rate. Statement II : RNA can directly code for synthesis of pr...

Select the correct statements about sickle cell anaemia. (A) There is a change in gene for beta globin. (B) In the beta globin, there is valine i...

Which one of the following acts as an inducer for lac operon ?

With reference to Hershey and Chase experiments. Select the correct statements. (A) Viruses grown in the presence of radioactive phosphorus contain...

The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific ...

Unequivocal proof that DNA is the genetic material was first proposed by

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Expressed Sequence Tags (ESTs) refers to

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:solid;border-width:1px;font-famil...

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region cal...

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AU...

In lac operon, z gene codes for

Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During re...

Match List - I with List - II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:solid;border-width:1px;font-f...

Match List-I with List-II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:solid;border-width:1px;font-famil...

Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?

If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?

The process of translation of mRNA to proteins begins as soon as:

DNA polymorphism forms the basis of:

Read the following statements and choose the set of correct statements: (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcripti...

Transposons can be used during which one of the following?

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the ...

If the length of a DNA molecule is 1.1 metres, what will b the approximate number of base pairs?

In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be th...

Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally fre...

DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as

Complete the flow chart on central dogma....

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as

Identify the correct statement.

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

Which of the following RNAs is not required for the synthesis of protein?

Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?

Which one of the following statements about histones is wrong?

Statement I : The codon 'AUG' codes for methionine and phenylalanine.Statement II : 'AAA' and 'AAG' both codons code for the amino acid lysine.In the ...

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is ...

Which of the following statements is correct?

The first phase of translation is

Name the enzyme that facilitates opening of DNA helix during transcription.

Under which of the following conditions will there be no change in the reading frame of following mRNA? 5' AACAGCGGUGCUAUU 3'

Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?

The shorter and longer arms of a submetacentric chromosome are referred to as:

Match the following genes of the Lac operon with their respective produces : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:bl...

Expressed Sequence Tags (ESTs) refers to :

Purines found both in DNA and RNA are:

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

All of the following are part of an operon except

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as

Select the correct match :

Select the correct statement :

The experimental proof for semi-conservative replication of DNA was first shown in a

Select the correct match :

The final proof for DNA as the genetic material came from the experiments of

Spliceosomes are not found in cells of :

Which of the following RNAs should be most abundant in animal cell ?

During DNA replication, Okazaki fragments are used to elongate

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RN...

The association of histone H1 with a nucleosome indicates :

DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the

A molecule that can act as a genetic material must fulfill the traits given below, except

Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria ?

The equivalent of a structural gene is -

Taylor conducted the experiments to prove semiconservative mode of chromosome replication on

A complex of ribosomes attached to a single strand of RNA is known as :

Which of the following is required as inducer(s) for the expression of Lac operon?

Which one of the following is the starter codon ?

Identify the correct order of organisation of genetic material from largest to smallest :

Which one of the following is not applicable to RNA?

Balbiani rings are sites of :

Satellite DNA is important because it :

Gene regulation governing lactose operon of E.coli that involves the lac I gene product is

In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine, The percentages of the other three bases expected to be prese...

Select the correct option ;

Transformation was discovered by :

The figure gives an important concept in the genetic implication of DNA . Fill the blanks A, B and C....

Satellite RNA are present in some :

Genes of interest can be selected from a genomic library by using :

In an inducible operon, the genes are :

One of the most frequently used techniques in DNA fingerprinting is :-

Which of the following is not a property of the genetic code ?

The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C. ...

Which enzyme will be produced in a cell in which there is a non-sense mutation in the lac Y gene ?

Which of the following statements is not true of two genes that show 50% recombination frequency ?

Removal of RNA polymerase -III from nucleoplasm will affect the synthesis of

Ribosomal RNA is actively synthesized in

If one strand of DNA has the nitrogenous base sequence as ATCTG, what would be the complementary RNA stand sequence

Which one of the following is not a part of a transcription unit in DNA ?

Removal of introns and joining of exons in a defined order during transcription is called

The unequivocal proof of DNA as the genetic material came from the studies on a :

What are those structures that appear as 'beads-on-string' in the chromosomes when viewed under electron microscope ?

In eukaryotic cell transcription, RNA splicing and RNA capping take place inside the -

The lac Operon consists of -

The 3'-5' phosphodiester linkages inside a polynucleotide chain serve to join -

Which one of the follwoing statements about the particular entity is true ?

Select the two correct statements out of the four (a-d) statements given below about lac operon. (a) Glucose or galactose may bind with the repressor...

The one aspect which is not a salient feature of genetic code, is its being –

Which one of the following palindromic base sequences in DNA can be easily cut at about the middle by some particular restriction enzyme?

Which one of the following does not follow the central dogma of molecular biology ?

What is not true for genetic code?

Whose experiments cracked the DNA and discovered unequivocally that a genetic code is a "triplet" ?

Semi-conservative replication of DNA was first demonstrated in :

Removal of introns and joining the exons in a defined order in a transcription unit is called :

Polysome is formed by

Which one of the following pairs of codons is correctly matched with their function or the signal for the particular amino acid ?

Which one of the following pairs of nitrogenous bases of nucleic acids, is wrongly matched with the category mentioned against it?

In the DNA molecule:

Amino acid sequence, in protein synthesis is decided by the sequence of -

Antiparallel strands of a DNA molecule means that-

Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis ?

One turn of the helix in a B-form DNA is approximately -

One gene-one enzyme hypothesis was postulated by -

Telomerase is an enzyme which is a -

E. coli cells with a mustard z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because -

Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mu...

Which one of the following hydrolyses internal phosphodiester bonds in a polynucleotide chain ?

Protein synthesis in an animal cell occurs -

Which one of the following makes use of RNA as a template to synthesize DNA -

During transcription holoenzyme RNA polymerase binds to a DNA sequence and the DNA assumes a saddle like structure at the point. What is the sequence ...

The following ratio is generally constant for a given species :-

Which form of RNA has a structure resembling clover leaf ?

During transcription, if the nucleotide sequence of the DNA strand that is being coded is ATACG, then the nucleotide sequence in the mRNA would be -

After a mutation at a genetic locus the character of an organism changes due to the change in :-

In a mutational event, when adenine is replaced by guanine, it is a case of -

During transcription, the DNA site at which RNA polymerase binds is called :-

In the genetic code dictionary, how many codons are used to code for all the 20 essential amino acids : -

What does "lac" refer to in what we call the lac operon ?

During translation initiation in prokaryotes, a GTP molecule is needed in : -

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA ?

Which one of the following triplet codes, is correctly matched with its specificity for an amino acid in protein synthesis or as 'start' or 'stop' cod...

Degeneration of a genetic code is attributed to the : -

Exon part of m-RNAs have code for : -

In a DNA percentage of thymine is 20% then what is the percentage of guanine : -

Transformation experiment was first performed on which bacteria : -

In E. Coli, during lactose metabolism repressor binds to : -

Jacob and Monad studied lactose metabolism in E.Coli and proposed operon concept. Operon concept applicable for :

Out of 64 codons, 61 codons code for 20 types of amino acid it is called : -

Which of the following reunites the exon segments after RNA splicing ?

Which of the following enzymes are used to join bits of DNA ?

Change in sequence of nucleotide in DNA is called as -

Gene and cistron words are sometimes used synonymously because : -

m-RNA is synthesised on DNA template in which direction : -

In Negative operon : -

Types of RNA polymerase required in nucleus for RNA synthesis : -

Similarity in DNA and RNA :

Which of the following is initiation codon ?

Method of DNA replication in which two strands of DNA separates and synthesize new strands

Anticodon occurs in :

In three dimensional view the molecule of t-RNA is :

Length of one loop of B- DNA :

Which one of the following is wrongly matched?