MCQ (Single Correct Answer)

1

Which chromosome in the human genome has the highest number of genes?

NEET 2025
2

Match List-I with List-II

List - I
List - II
A Alfred Hershey and Martha Chase I Streptococcus pneumoniae
B Euchromatin II Densely packed and dark-stained
C Frederick Griffith III Loosely packed and light-stained
D Heterochromatin IV DNA as genetic material confirmation

Choose the correct answer from the options given below:

NEET 2025
3

Which of the following are the post-transcriptional events in an eukaryotic cell?

A. Transport of pre-mRNA to cytoplasm prior to splicing.

B. Removal of introns and joining of exons.

C. Addition of methyl group at 5' end of hnRNA.

D. Addition of adenine residues at 3' end of hnRNA.

E. Base pairing of two complementary RNAs.

Choose the correct answer from the options given below :

NEET 2025
4

Given below are two statements:

Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable.

Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism.

In the light of the above statements, choose the most appropriate answer from the options given below :

NEET 2025
5

Given below are two statements :

Statement 1 : Transfer RNAs and ribosomal RNA do not interact with mRNA.

Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.

In the light of the above statements, choose the most appropriate answer from the options given below :

NEET 2025
6

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

NEET 2025
7

Which factor is important for termination of transcription?

NEET 2025
8

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

NEET 2024 (Re-Examination)
9

Given below are two statements regarding RNA polymerase in prokaryotes.

Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription.

Statement II : RNA polymerase associate transiently with ‘Rho’ factor to initiate transcription.

In the light of the above statements, choose the correct answer from the options given below :

NEET 2024 (Re-Examination)
10

Given below are two statements:

Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles.

Statement II: All the three RNA polymerases in eukaryotic nucleus have different roles.

In the light of the above statements, choose the correct answer from the options given below:

NEET 2024 (Re-Examination)
11

Given below are two statements :

Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense.

Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA molecule that binds and prevents translation of mRNA

In the light of the above statements, choose the correct answer from the options given below.

NEET 2024 (Re-Examination)
12

The lactose present in the growth medium of bacteria is transported to the cell by the action of

NEET 2024
13

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

NEET 2024
14

Which of the following statement is correct regarding the process of replication in E.coli?

NEET 2024
15

Match List I with List II

List - I List - II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Tranformation
D. Meselson & Stahl IV. Lac operon

Choose the correct answer from the options given below:

NEET 2024
16

Match List I with List II :

List - I List - II
A. Down's syndrome I. 11$$^\mathrm{th}$$ chromosome
B. $$\alpha$$-thalassemia II. 'X' chromosome
C. $$\beta$$-thalassemia III. 21$$^\mathrm{st}$$ chromosome
D. Klinefelter's syndrome IV. 16$$^\mathrm{th}$$ chromosome

Choose the correct answer from the options given below :

NEET 2024
17

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3'TACATGGCAAATATCCATTCA5'

NEET 2024
18

Match List I with List II:

List - I List - II
A. RNA polymerase III I. snRNPs
B. Termination of transcription II. Promotor
C. Splicing of Exons III. Rho factor
D. TATA box IV. SnRNAs, tRNA

Choose the correct answer from the options given below :

NEET 2024
19

The last chromosome sequenced in Human Genome Project was:

NEET 2023 Manipur
20

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

NEET 2023 Manipur
21

Given below are two statements :

Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcription.

Statement II : A transcription unit in DNA is defined primarily by the three regions in the DNA i.e., a promotor, the structural gene and a terminator.

In the light of the above statements, choose the correct answer from the options given below :

NEET 2023 Manipur
22

Which scientist conducted an experiment with 32P and 35S labelled phages for demonstrating that DNA is the genetic material?

NEET 2023 Manipur
23

Given below are two statements :

Statement I : RNA being unstable, mutate at a faster rate.

Statement II : RNA can directly code for synthesis of proteins hence can easily express the characters.

In the light of the above statements, choose the correct answer from the options given below :

NEET 2023 Manipur
24

Select the correct statements about sickle cell anaemia.

(A) There is a change in gene for beta globin.

(B) In the beta globin, there is valine in the place of Lysine.

(C) It is an example of point mutation.

(D) In the normal gene U is replaced by A.

Choose the correct answer from the options given below :

NEET 2023 Manipur
25

Which one of the following acts as an inducer for lac operon ?

NEET 2023 Manipur
26

With reference to Hershey and Chase experiments. Select the correct statements.

(A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA.

(B) Viruses grown on radioactive sulphur contained radioactive proteins.

(C) Viruses grown on radioactive phosphorus contained radioactive protein.

(D) Viruses grown on radioactive sulphur contained radioactive DNA.

(E) Viruses grown on radioactive protein contained radioactive DNA.

Choose the most appropriate answer from the options given below :

NEET 2023 Manipur
27

The salient features of genetic code are :

(A) The code is palindromic

(B) UGA act as initiator codon

(C) The code is unambiguous and specific

(D) The code is nearly universal

Choose the most appropriate answer from the options given below :

NEET 2023 Manipur
28

Unequivocal proof that DNA is the genetic material was first proposed by

NEET 2023
29

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

NEET 2023
30

Expressed Sequence Tags (ESTs) refers to

NEET 2023
31

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

NEET 2023
32

Match List I with List II.

List I List II
(A) Gene 'a' (I) $$\beta$$-galactosidase
(B) Gene 'y' (II) Transacetylase
(C) Gene 'i' (III) Permease
(D) Gene 'z' (IV) Repressor protein

Choose the correct answer from the options given below :

NEET 2023
33

Given below are two statements:

Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.

Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

In the light of the above statements, choose the correct answer from the options given below:

NEET 2023
34

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

NEET 2023
35

In lac operon, z gene codes for

NEET 2022 Phase 2
36

Given below are two statements

Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'.

Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is discontinuous.

In the light of the above statements, choose the correct answer from the options given below:

NEET 2022 Phase 2
37

Match List - I with List - II.

List - I List - II
(a) In Iac operon i gene codes for (i) transacetylase
(b) In Iac operon z gene codes for (ii) permease
(c) In Iac operon y gene codes for (iii) $$\beta$$-galactosidase
(d) In Iac operon a gene codes for (iv) Repressor

Choose the correct answer from the options given below

NEET 2022 Phase 2
38

Match List-I with List-II:

List - I List - II
(a) Bacteriophage $$\phi$$ $$\times$$ 174 (i) 48502 base pairs
(b) Bacteriophage lambda (ii) 5386 nucleotides
(c) Escherichia coli (iii) 3.3 $$\times$$ 10$$^9$$ base pairs
(d) Haploid content of human DNA (iv) 4.6 $$\times$$ 10$$^6$$ base pairs

Choose the correct answer from the options given below:

NEET 2022 Phase 2
39

Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?

NEET 2022 Phase 2
40

If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?

NEET 2022 Phase 2
41

The process of translation of mRNA to proteins begins as soon as:

NEET 2022 Phase 1
42

DNA polymorphism forms the basis of:

NEET 2022 Phase 1
43

Read the following statements and choose the set of correct statements:

(a) Euchromatin is loosely packed chromatin

(b) Heterochromatin is transcriptionally active

(c) Histone octamer is wrapped by negatively charged DNA in nucleosome

(d) Histones are rich in lysine and arginine

(e) A typical nucleosome contains 400 bp of DNA helix

Choose the correct answer from the options given below :

NEET 2022 Phase 1
44

Transposons can be used during which one of the following?

NEET 2022 Phase 1
45

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :

NEET 2022 Phase 1
46

If the length of a DNA molecule is 1.1 metres, what will b the approximate number of base pairs?

NEET 2022 Phase 1
47

In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

NEET 2022 Phase 1
48

Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from 15N?

NEET 2022 Phase 1
49
DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as
NEET 2021
50
Complete the flow chart on central dogma.

NEET 2021 Biology - Molecular Basis of Inheritance Question 56 English
NEET 2021
51
What is the role of RNA polymerase III in the process of transcription in eukaryotes?
NEET 2021
52
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as
NEET 2021
53
Identify the correct statement.
NEET 2021
54
If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?
NEET 2021
55
Which of the following RNAs is not required for the synthesis of protein?
NEET 2021
56
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
NEET 2021
57
Which one of the following statements about histones is wrong?
NEET 2021
58
Statement I : The codon 'AUG' codes for methionine and phenylalanine.

Statement II : 'AAA' and 'AAG' both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.
NEET 2021
59
If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 109 bp, then the length of the DNA is approximately
NEET 2020 Phase 1
60
Which of the following statements is correct?
NEET 2020 Phase 1
61
The first phase of translation is
NEET 2020 Phase 1
62
Name the enzyme that facilitates opening of DNA helix during transcription.
NEET 2020 Phase 1
63
Under which of the following conditions will there be no change in the reading frame of following mRNA?

5' AACAGCGGUGCUAUU 3'
NEET 2019
64
Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?
NEET 2019
65
The shorter and longer arms of a submetacentric chromosome are referred to as:
NEET 2019
66
Match the following genes of the Lac operon with their respective produces :

(a) i gene (i) $$\beta $$-galactosidase
(b) z gene (ii) Permease
(c) a gene (iii) Repressor
(d) y gene (iv) Transacetylase

Select the correct option.
NEET 2019
67
Purines found both in DNA and RNA are:
NEET 2019
68
Expressed Sequence Tags (ESTs) refers to :
NEET 2019
69
All of the following are part of an operon except
NEET 2018
70
AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?
NEET 2018
71
Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as
NEET 2018
72
Select the correct match :
NEET 2018
73
Select the correct statement :
NEET 2018
74
The experimental proof for semi-conservative replication of DNA was first shown in a
NEET 2018
75
Select the correct match :
NEET 2018
76
The final proof for DNA as the genetic material came from the experiments of
NEET 2017
77
Spliceosomes are not found in cells of :
NEET 2017
78
The association of histone H1 with a nucleosome indicates :
NEET 2017
79
If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ?
NEET 2017
80
Which of the following RNAs should be most abundant in animal cell ?
NEET 2017
81
During DNA replication, Okazaki fragments are used to elongate
NEET 2017
82
DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the
NEET 2016 Phase 2
83
A molecule that can act as a genetic material must fulfill the traits given below, except
NEET 2016 Phase 2
84
Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria ?
NEET 2016 Phase 2
85
The equivalent of a structural gene is -
NEET 2016 Phase 2
86
Taylor conducted the experiments to prove semiconservative mode of chromosome replication on
NEET 2016 Phase 2
87
A complex of ribosomes attached to a single strand of RNA is known as :
NEET 2016 Phase 1
88
Which of the following is required as inducer(s) for the expression of Lac operon?
NEET 2016 Phase 1
89
Which one of the following is the starter codon ?
NEET 2016 Phase 1
90
Identify the correct order of organisation of genetic material from largest to smallest :
AIPMT 2015
91
Which one of the following is not applicable to RNA?
AIPMT 2015
92
Balbiani rings are sites of :
AIPMT 2015
93
Satellite DNA is important because it :
AIPMT 2015
94
Gene regulation governing lactose operon of E.coli that involves the lac I gene product is
AIPMT 2015 Cancelled Paper
95
In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine, The percentages of the other three bases expected to be present in this DNA are
AIPMT 2015 Cancelled Paper
96
Select the correct option ;
AIPMT 2014
97
Transformation was discovered by :
AIPMT 2014
98
NEET 2013 (Karnataka) Biology - Molecular Basis of Inheritance Question 147 English The figure gives an important concept in the genetic implication of DNA . Fill the blanks A, B and C.
NEET 2013 (Karnataka)
99
Satellite RNA are present in some :
NEET 2013 (Karnataka)
100
Genes of interest can be selected from a genomic library by using :
NEET 2013 (Karnataka)
101
In an inducible operon, the genes are :
NEET 2013 (Karnataka)
102
One of the most frequently used techniques in DNA fingerprinting is :-
NEET 2013 (Karnataka)
103
Which of the following is not a property of the genetic code ?
NEET 2013 (Karnataka)
104
The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C. NEET 2013 Biology - Molecular Basis of Inheritance Question 149 English
NEET 2013
105
Which enzyme will be produced in a cell in which there is a non-sense mutation in the lac Y gene ?
NEET 2013
106
Which of the following statements is not true of two genes that show 50% recombination frequency ?
NEET 2013
107
Removal of RNA polymerase -III from nucleoplasm will affect the synthesis of
AIPMT 2012 Prelims
108
Ribosomal RNA is actively synthesized in
AIPMT 2012 Prelims
109
If one strand of DNA has the nitrogenous base sequence as ATCTG, what would be the complementary RNA stand sequence
AIPMT 2012 Prelims
110
Which one of the following is not a part of a transcription unit in DNA ?
AIPMT 2012 Prelims
111
Removal of introns and joining of exons in a defined order during transcription is called
AIPMT 2012 Prelims
112
The unequivocal proof of DNA as the genetic material came from the studies on a :
AIPMT 2011 Mains
113
What are those structures that appear as 'beads-on-string' in the chromosomes when viewed under electron microscope ?
AIPMT 2011 Prelims
114
In eukaryotic cell transcription, RNA splicing and RNA capping take place inside the -
AIPMT 2010 Mains
115
The lac Operon consists of -
AIPMT 2010 Mains
116
The 3'-5' phosphodiester linkages inside a polynucleotide chain serve to join -
AIPMT 2010 Mains
117
Which one of the follwoing statements about the particular entity is true ?
AIPMT 2010 Mains
118
Select the two correct statements out of the four (a-d) statements given below about lac operon.
(a) Glucose or galactose may bind with the repressor and inactivate it
(b) In the absence of lactose the repressor binds with the operator region
(c) The z-gene codes for permease
(d) This was elucidated by Francois Jacob and Jacque Monod
The correct statements are :
AIPMT 2010 Prelims
119
The one aspect which is not a salient feature of genetic code, is its being –
AIPMT 2010 Prelims
120
Which one of the following palindromic base sequences in DNA can be easily cut at about the middle by some particular restriction enzyme?
AIPMT 2010 Prelims
121
Which one of the following does not follow the central dogma of molecular biology ?
AIPMT 2010 Prelims
122
What is not true for genetic code?
AIPMT 2009
123
Whose experiments cracked the DNA and discovered unequivocally that a genetic code is a "triplet" ?
AIPMT 2009
124
Semi-conservative replication of DNA was first demonstrated in :
AIPMT 2009
125
Removal of introns and joining the exons in a defined order in a transcription unit is called :
AIPMT 2009
126
Polysome is formed by
AIPMT 2008
127
Which one of the following pairs of codons is correctly matched with their function or the signal for the particular amino acid ?
AIPMT 2008
128
Which one of the following pairs of nitrogenous bases of nucleic acids, is wrongly matched with the category mentioned against it?
AIPMT 2008
129
In the DNA molecule:
AIPMT 2008
130
Amino acid sequence, in protein synthesis is decided by the sequence of -
AIPMT 2006
131
Antiparallel strands of a DNA molecule means that-
AIPMT 2006
132
Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis ?
AIPMT 2006
133
One turn of the helix in a B-form DNA is approximately -
AIPMT 2006
134
One gene-one enzyme hypothesis was postulated by -
AIPMT 2006
135
Telomerase is an enzyme which is a -
AIPMT 2005
136
E. coli cells with a mustard z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because -
AIPMT 2005
137
Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mutations do not originates as adaptation. These imprints need to be used -
AIPMT 2005
138
Which one of the following hydrolyses internal phosphodiester bonds in a polynucleotide chain ?
AIPMT 2005
139
Protein synthesis in an animal cell occurs -
AIPMT 2005
140
Which one of the following makes use of RNA as a template to synthesize DNA -
AIPMT 2005
141
During transcription holoenzyme RNA polymerase binds to a DNA sequence and the DNA assumes a saddle like structure at the point. What is the sequence called ?
AIPMT 2005
142
The following ratio is generally constant for a given species :-
AIPMT 2004
143
Which form of RNA has a structure resembling clover leaf ?
AIPMT 2004
144
During transcription, if the nucleotide sequence of the DNA strand that is being coded is ATACG, then the nucleotide sequence in the mRNA would be -
AIPMT 2004
145
After a mutation at a genetic locus the character of an organism changes due to the change in :-
AIPMT 2004
146
In a mutational event, when adenine is replaced by guanine, it is a case of -
AIPMT 2004
147
During transcription, the DNA site at which RNA polymerase binds is called :-
AIPMT 2003
148
In the genetic code dictionary, how many codons are used to code for all the 20 essential amino acids : -
AIPMT 2003
149
What does "lac" refer to in what we call the lac operon ?
AIPMT 2003
150
During translation initiation in prokaryotes, a GTP molecule is needed in : -
AIPMT 2003
151
What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA ?
AIPMT 2003
152
Which one of the following triplet codes, is correctly matched with its specificity for an amino acid in protein synthesis or as 'start' or 'stop' codon ?
AIPMT 2003
153
Degeneration of a genetic code is attributed to the : -
AIPMT 2003
154
Exon part of m-RNAs have code for : -
AIPMT 2002
155
In a DNA percentage of thymine is 20% then what is the percentage of guanine : -
AIPMT 2002
156
Transformation experiment was first performed on which bacteria : -
AIPMT 2002
157
In E. Coli, during lactose metabolism repressor binds to : -
AIPMT 2002
158
Jacob and Monad studied lactose metabolism in E.Coli and proposed operon concept. Operon concept applicable for :
AIPMT 2002
159
Out of 64 codons, 61 codons code for 20 types of amino acid it is called : -
AIPMT 2002
160
Which of the following reunites the exon segments after RNA splicing ?
AIPMT 2002
161
Which of the following enzymes are used to join bits of DNA ?
AIPMT 2002
162
Change in sequence of nucleotide in DNA is called as -
AIPMT 2002
163
Gene and cistron words are sometimes used synonymously because : -
AIPMT 2001
164
m-RNA is synthesised on DNA template in which direction : -
AIPMT 2001
165
In Negative operon : -
AIPMT 2001
166
Types of RNA polymerase required in nucleus for RNA synthesis : -
AIPMT 2001
167
Similarity in DNA and RNA :
AIPMT 2000
168
Which of the following is initiation codon ?
AIPMT 2000
169
Method of DNA replication in which two strands of DNA separates and synthesize new strands
AIPMT 2000
170
Anticodon occurs in :
AIPMT 2000
171
In three dimensional view the molecule of t-RNA is :
AIPMT 2000
172
Length of one loop of B- DNA :
AIPMT 2000

MCQ (More than One Correct Answer)

EXAM MAP