Molecular Basis of Inheritance · Biology · NEET
Start PracticeMCQ (Single Correct Answer)
NEET 2024 (Re-Examination)
In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:
NEET 2024 (Re-Examination)
Given below are two statements regarding RNA polymerase in prokaryotes.
Statement I : In prokaryotes, RNA polymerase is capable of catalysing the proc...
NEET 2024 (Re-Examination)
Given below are two statements:
Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA
polymerase found in t...
NEET 2024 (Re-Examination)
Given below are two statements :
Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense.
Statement II : ...
NEET 2024
The lactose present in the growth medium of bacteria is transported to the cell by the action of
NEET 2024
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
NEET 2024
Which of the following statement is correct regarding the process of replication in E.coli?
NEET 2024
Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family...
NEET 2024
Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-fami...
NEET 2024
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
NEET 2024
Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-famil...
NEET 2023 Manipur
The last chromosome sequenced in Human Genome Project was:
NEET 2023 Manipur
Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.
NEET 2023 Manipur
Given below are two statements :
Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcript...
NEET 2023 Manipur
Which scientist conducted an experiment with 32P
and 35S labelled phages for demonstrating that DNA is the genetic material? ...
NEET 2023 Manipur
Given below are two statements :
Statement I : RNA being unstable, mutate at a faster rate.
Statement II : RNA can directly code for synthesis of pr...
NEET 2023 Manipur
Select the correct statements about sickle cell
anaemia.
(A) There is a change in gene for beta globin.
(B) In the beta globin, there is valine i...
NEET 2023 Manipur
Which one of the following acts as an inducer for
lac operon ?
NEET 2023 Manipur
With reference to Hershey and Chase experiments.
Select the correct statements.
(A) Viruses grown in the presence of radioactive
phosphorus contain...
NEET 2023 Manipur
The salient features of genetic code are :
(A) The code is palindromic
(B) UGA act as initiator codon
(C) The code is unambiguous and specific
...
NEET 2023
Unequivocal proof that DNA is the genetic material was first proposed by
NEET 2023
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
NEET 2023
Expressed Sequence Tags (ESTs) refers to
NEET 2023
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
NEET 2023
Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-famil...
NEET 2023
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a
region cal...
NEET 2023
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AU...
NEET 2022 Phase 2
In lac operon, z gene codes for
NEET 2022 Phase 2
Given below are two statements
Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'.
Statement II : During re...
NEET 2022 Phase 2
Match List - I with List - II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-f...
NEET 2022 Phase 2
Match List-I with List-II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-famil...
NEET 2022 Phase 2
Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?
NEET 2022 Phase 2
If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?
NEET 2022 Phase 1
The process of translation of mRNA to proteins begins as soon as:
NEET 2022 Phase 1
DNA polymorphism forms the basis of:
NEET 2022 Phase 1
Read the following statements and choose the set of correct statements:
(a) Euchromatin is loosely packed chromatin
(b) Heterochromatin is transcripti...
NEET 2022 Phase 1
Transposons can be used during which one of the following?
NEET 2022 Phase 1
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the ...
NEET 2022 Phase 1
If the length of a DNA molecule is 1.1 metres, what will b the approximate number of base pairs?
NEET 2022 Phase 1
In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be th...
NEET 2022 Phase 1
Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally fre...
NEET 2021
DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as
NEET 2021
Complete the flow chart on central dogma....
NEET 2021
What is the role of RNA polymerase III in the process of transcription in eukaryotes?
NEET 2021
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as
NEET 2021
Identify the correct statement.
NEET 2021
If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?
NEET 2021
Which of the following RNAs is not required for the synthesis of protein?
NEET 2021
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
NEET 2021
Which one of the following statements about histones is wrong?
NEET 2021
Statement I : The codon 'AUG' codes for methionine and phenylalanine.Statement II : 'AAA' and 'AAG' both codons code for the amino acid lysine.In the ...
NEET 2020 Phase 1
If the distance between two consecutive base
pairs is 0.34 nm and the total number of base
pairs of a DNA double helix in a typical
mammalian cell is ...
NEET 2020 Phase 1
Which of the following statements is correct?
NEET 2020 Phase 1
The first phase of translation is
NEET 2020 Phase 1
Name the enzyme that facilitates opening of
DNA helix during transcription.
NEET 2019
Purines found both in DNA and RNA are:
NEET 2019
Expressed Sequence Tags (ESTs) refers to :
NEET 2019
Match the following genes of the Lac operon with their respective produces :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:bl...
NEET 2019
Under which of the following conditions will there be no change in the reading frame of following mRNA?
5' AACAGCGGUGCUAUU 3'
NEET 2019
Which of the following features of genetic code does allow bacteria to produce human insulin by
recombinant DNA technology?
NEET 2019
The shorter and longer arms of a submetacentric chromosome are referred to as:
NEET 2018
Select the correct match :
NEET 2018
The experimental proof for semi-conservative
replication of DNA was first shown in a
NEET 2018
Select the correct statement :
NEET 2018
Select the correct match :
NEET 2018
Many ribosomes may associate with a single
mRNA to form multiple copies of a polypeptide
simultaneously. Such strings of ribosomes are
termed as
NEET 2018
All of the following are part of an operon except
NEET 2018
AGGTATCGCAT is a sequence from the coding
strand of a gene. What will be the corresponding
sequence of the transcribed mRNA?
NEET 2017
If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is
deleted such that the length of the RN...
NEET 2017
Which of the following RNAs should be most abundant in animal cell ?
NEET 2017
The association of histone H1 with a nucleosome indicates :
NEET 2017
The final proof for DNA as the genetic material came from the experiments of
NEET 2017
During DNA replication, Okazaki fragments are used to elongate
NEET 2017
Spliceosomes are not found in cells of :
NEET 2016 Phase 2
DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the
NEET 2016 Phase 2
A molecule that can act as a genetic material must fulfill the traits given below, except
NEET 2016 Phase 2
The equivalent of a structural gene is -
NEET 2016 Phase 2
Taylor conducted the experiments to prove semiconservative mode of chromosome replication on
NEET 2016 Phase 2
Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria ?
NEET 2016 Phase 1
A complex of ribosomes attached to a single strand of RNA is known as :
NEET 2016 Phase 1
Which of the following is required as inducer(s) for the expression of Lac operon?
NEET 2016 Phase 1
Which one of the following is the starter codon ?
AIPMT 2015
Satellite DNA is important because it :
AIPMT 2015
Identify the correct order of organisation of
genetic material from largest to smallest :
AIPMT 2015
Balbiani rings are sites of :
AIPMT 2015
Which one of the following is not
applicable to RNA?
AIPMT 2015 Cancelled Paper
In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine, The percentages of the other three bases expected to be prese...
AIPMT 2015 Cancelled Paper
Gene regulation governing lactose operon of E.coli that involves the lac I gene product is
AIPMT 2014
Select the correct option ;
AIPMT 2014
Transformation was discovered by :
NEET 2013 (Karnataka)
In an inducible operon, the genes are :
NEET 2013 (Karnataka)
The figure gives an important concept in the genetic
implication of DNA . Fill the blanks A, B and C....
NEET 2013 (Karnataka)
Satellite RNA are present in some :
NEET 2013 (Karnataka)
Which of the following is not a property of the
genetic code ?
NEET 2013 (Karnataka)
Genes of interest can be selected from a genomic
library by using :
NEET 2013 (Karnataka)
One of the most frequently used techniques in DNA
fingerprinting is :-
NEET 2013
The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C.
...
NEET 2013
Which enzyme will be produced in a cell in which there is a non-sense mutation in the lac Y gene ?
NEET 2013
Which of the following statements is not true of two genes that show 50% recombination frequency ?
AIPMT 2012 Prelims
Removal of RNA polymerase -III from nucleoplasm will affect the synthesis of
AIPMT 2012 Prelims
Ribosomal RNA is actively synthesized in
AIPMT 2012 Prelims
Which one of the following is not a part of a transcription unit in DNA ?
AIPMT 2012 Prelims
Removal of introns and joining of exons in a defined order during transcription is called
AIPMT 2012 Prelims
If one strand of DNA has the nitrogenous base sequence as ATCTG, what would be the
complementary RNA stand sequence
AIPMT 2011 Mains
The unequivocal proof of DNA as the genetic
material came from the studies on a :
AIPMT 2011 Prelims
What are those structures that appear as 'beads-on-string' in the chromosomes when viewed
under electron microscope ?
AIPMT 2010 Mains
Which one of the follwoing statements about the
particular entity is true ?
AIPMT 2010 Mains
In eukaryotic cell transcription, RNA splicing
and RNA capping take place inside the -
AIPMT 2010 Mains
The lac Operon consists of -
AIPMT 2010 Mains
The 3'-5' phosphodiester linkages inside a
polynucleotide chain serve to join -
AIPMT 2010 Prelims
Select the two correct statements out of the four
(a-d) statements given below about lac operon.
(a) Glucose or galactose may bind with the
repressor...
AIPMT 2010 Prelims
The one aspect which is not a salient feature of
genetic code, is its being –
AIPMT 2010 Prelims
Which one of the following palindromic base
sequences in DNA can be easily cut at about the
middle by some particular restriction enzyme?
AIPMT 2010 Prelims
Which one of the following does not follow the
central dogma of molecular biology ?
AIPMT 2009
Whose experiments cracked the DNA and
discovered unequivocally that a genetic code is a
"triplet" ?
AIPMT 2009
What is not true for genetic code?
AIPMT 2009
Removal of introns and joining the exons in a
defined order in a transcription unit is called :
AIPMT 2009
Semi-conservative replication of DNA was first
demonstrated in :
AIPMT 2008
Which one of the following pairs of codons is
correctly matched with their function or the
signal for the particular amino acid ?
AIPMT 2008
Polysome is formed by
AIPMT 2008
Which one of the following pairs of nitrogenous
bases of nucleic acids, is wrongly matched with
the category mentioned against it?
AIPMT 2008
In the DNA molecule:
AIPMT 2006
Amino acid sequence, in protein synthesis is
decided by the sequence of -
AIPMT 2006
One turn of the helix in a B-form DNA is
approximately -
AIPMT 2006
One gene-one enzyme hypothesis was
postulated by -
AIPMT 2006
Antiparallel strands of a DNA molecule means
that-
AIPMT 2006
Which antibiotic inhibits interaction between
tRNA and mRNA during bacterial protein
synthesis ?
AIPMT 2005
During transcription holoenzyme RNA
polymerase binds to a DNA sequence and the
DNA assumes a saddle like structure at the point.
What is the sequence ...
AIPMT 2005
Which one of the following makes use of RNA
as a template to synthesize DNA -
AIPMT 2005
Protein synthesis in an animal cell occurs -
AIPMT 2005
Which one of the following hydrolyses internal
phosphodiester bonds in a polynucleotide chain ?
AIPMT 2005
Using imprints from a plate with complete
medium and carrying bacterial colonies, you
can select streptomycin resistant mutants and
prove that such mu...
AIPMT 2005
Telomerase is an enzyme which is a -
AIPMT 2005
E. coli cells with a mustard z gene of the lac
operon cannot grow in medium containing only
lactose as the source of energy because -
AIPMT 2004
After a mutation at a genetic locus the character
of an organism changes due to the change in :-
AIPMT 2004
During transcription, if the nucleotide sequence
of the DNA strand that is being coded is
ATACG, then the nucleotide sequence in the
mRNA would be -
AIPMT 2004
Which form of RNA has a structure resembling
clover leaf ?
AIPMT 2004
In a mutational event, when adenine is replaced
by guanine, it is a case of -
AIPMT 2004
The following ratio is generally constant for a
given species :-
AIPMT 2003
Which one of the following triplet codes, is
correctly matched with its specificity for an
amino acid in protein synthesis or as 'start' or
'stop' cod...
AIPMT 2003
What does "lac" refer to in what we call the lac
operon ?
AIPMT 2003
During transcription, the DNA site at which
RNA polymerase binds is called :-
AIPMT 2003
Degeneration of a genetic code is attributed to
the : -
AIPMT 2003
What would happen if in a gene encoding a
polypeptide of 50 amino acids, 25th codon
(UAU) is mutated to UAA ?
AIPMT 2003
In the genetic code dictionary, how many
codons are used to code for all the 20 essential
amino acids : -
AIPMT 2003
During translation initiation in prokaryotes, a
GTP molecule is needed in : -
AIPMT 2002
Which of the following reunites the exon
segments after RNA splicing ?
AIPMT 2002
In a DNA percentage of thymine is 20% then
what is the percentage of guanine : -
AIPMT 2002
Jacob and Monad studied lactose metabolism in
E.Coli and proposed operon concept. Operon
concept applicable for :
AIPMT 2002
Transformation experiment was first performed
on which bacteria : -
AIPMT 2002
In E. Coli, during lactose metabolism repressor
binds to : -
AIPMT 2002
Exon part of m-RNAs have code for : -
AIPMT 2002
Which of the following enzymes are used to join
bits of DNA ?
AIPMT 2002
Change in sequence of nucleotide in DNA is
called as -
AIPMT 2002
Out of 64 codons, 61 codons code for 20 types
of amino acid it is called : -
AIPMT 2001
Types of RNA polymerase required in nucleus
for RNA synthesis : -
AIPMT 2001
Gene and cistron words are sometimes used
synonymously because : -
AIPMT 2001
In Negative operon : -
AIPMT 2001
m-RNA is synthesised on DNA template in
which direction : -
AIPMT 2000
Similarity in DNA and RNA :
AIPMT 2000
Anticodon occurs in :
AIPMT 2000
In three dimensional view the molecule of
t-RNA is :
AIPMT 2000
Length of one loop of B- DNA :
AIPMT 2000
Method of DNA replication in which two
strands of DNA separates and synthesize new
strands
AIPMT 2000
Which of the following is initiation codon ?
MCQ (More than One Correct Answer)
AIPMT 2014
Which one of the following is wrongly matched?