1
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
2
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Match List I with List II.
List I | List II | ||
---|---|---|---|
(A) | Gene 'a' | (I) | $$\beta$$-galactosidase |
(B) | Gene 'y' | (II) | Transacetylase |
(C) | Gene 'i' | (III) | Permease |
(D) | Gene 'z' | (IV) | Repressor protein |
Choose the correct answer from the options given below :
3
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
4
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
Questions Asked from Molecular Basis of Inheritance (MCQ (Single Correct Answer))
Number in Brackets after Paper Indicates No. of Questions
NEET 2023 Manipur (9)
NEET 2023 (7)
NEET 2022 Phase 2 (5)
NEET 2022 Phase 1 (8)
NEET 2021 (10)
NEET 2020 Phase 1 (4)
NEET 2019 (6)
NEET 2018 (7)
NEET 2017 (6)
NEET 2016 Phase 2 (5)
NEET 2016 Phase 1 (3)
AIPMT 2015 (4)
AIPMT 2015 Cancelled Paper (2)
AIPMT 2014 (2)
NEET 2013 (Karnataka) (6)
NEET 2013 (3)
AIPMT 2012 Prelims (5)
AIPMT 2011 Mains (1)
AIPMT 2011 Prelims (1)
AIPMT 2010 Mains (4)
AIPMT 2010 Prelims (4)
AIPMT 2009 (4)
AIPMT 2008 (4)
AIPMT 2006 (5)
AIPMT 2005 (7)
AIPMT 2004 (5)
AIPMT 2003 (7)
AIPMT 2002 (9)
AIPMT 2001 (4)
AIPMT 2000 (6)
NEET Subjects
Physics
Mechanics
Units & Measurement
Motion in a Straight Line
Motion in a Plane
Laws of Motion
Work, Energy and Power
Center of Mass and Collision
Rotational Motion
Gravitation
Properties of Matter
Heat and Thermodynamics
Oscillations
Waves
Electricity
Electrostatics
Current Electricity
Moving Charges and Magnetism
Magnetism and Matter
Electromagnetic Induction and Alternating Current
Electromagnetic Waves
Optics
Modern Physics
Chemistry
Physical Chemistry
Some Basic Concepts of Chemistry
Structure of Atom
Redox Reactions
Gaseous State
Equilibrium
Chemical Kinetics
Solutions
Thermodynamics
Electrochemistry
Nuclear Chemistry
Solid State
Surface Chemistry
Inorganic Chemistry
Periodic Table and Periodicity
Chemical Bonding and Molecular Structure
Processes of Isolation of Elements
s-Block Elements
Hydrogen
p-Block Elements
d and f Block Elements
Coordination Compounds
Environmental Chemistry
Organic Chemistry
Biology
Botany
Cell - The Unit of Life
Biomolecules
Cell Cycle and Cell Division
Sexual Reproduction in Flowering Plants
Microbes in Human Welfare
Anatomy of Flowering Plants
Transport in Plants
Mineral Nutrition
Respiration in Plants
Biotechnology: Principles and Processes
Biodiversity and Conservation
The Living World
Biological Classification
Morphology of Flowering Plants
Photosynthesis in Higher Plants
Principles of Inheritance and Variation
Molecular Basis of Inheritance
Strategies for Enhancement in Food Production
Biotechnology and It's Applications
Organisms and Populations
Environmental Issues
Plant Kingdom
Plant Growth and Development
Ecosystem
Zoology
Human Health and Diseases
Body Fluids and Its Circulation
Locomotion and Movement
Neural Control and Coordination
Reproduction in Organisms
Reproductive Health
Structural Organisation in Animals
Digestion and Absorption
Excretory Products and Their Elimination
Chemical Coordination and Integration
Human Reproduction
Animal Kingdom
Breathing and Exchange of Gases
Evolution