Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Gene 'a' | (I) | $$\beta$$-galactosidase |
| (B) | Gene 'y' | (II) | Transacetylase |
| (C) | Gene 'i' | (III) | Permease |
| (D) | Gene 'z' | (IV) | Repressor protein |
Choose the correct answer from the options given below :
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
NEET Subjects
Browse all chapters by subject