1
NEET 2023
MCQ (Single Correct Answer)
+4
-1

Match List I with List II.

List I List II
(A) Gene 'a' (I) $$\beta$$-galactosidase
(B) Gene 'y' (II) Transacetylase
(C) Gene 'i' (III) Permease
(D) Gene 'z' (IV) Repressor protein

Choose the correct answer from the options given below :

A
A-II, B-III, C-IV, D-I
B
A-III, B-IV, C-I, D-II
C
A-III, B-I, C-IV, D-II
D
A-II, B-I, C-IV, D-III
2
NEET 2023
MCQ (Single Correct Answer)
+4
-1

Given below are two statements:

Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.

Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

In the light of the above statements, choose the correct answer from the options given below:

A
Both Statement I and Statement II are false.
B
Statement I is correct but Statement II is false.
C
Statement I is incorrect but Statement II is true.
D
Both Statement I and Statement II are true.
3
NEET 2023
MCQ (Single Correct Answer)
+4
-1

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

A
3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
B
5’ ATCGATCGATCGATCGATCGATCGATCG 3’
C
3’ ATCGATCGATCGATCGATCGATCGATCG 5’
D
5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
4
NEET 2022 Phase 2
MCQ (Single Correct Answer)
+4
-1

In lac operon, z gene codes for

A
Transacetylase
B
$$\beta$$-galactosidase
C
Permease
D
Repressor
NEET Subjects
EXAM MAP
Joint Entrance Examination
JEE MainJEE AdvancedWB JEEBITSATMHT CET
Medical
NEET
Graduate Aptitude Test in Engineering
GATE CSEGATE ECEGATE EEGATE MEGATE CEGATE PIGATE IN