Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
In lac operon, z gene codes for
Given below are two statements
Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'.
Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is discontinuous.
In the light of the above statements, choose the correct answer from the options given below: