NEET 2024
Paper was held on Sun, May 5, 2024 8:30 AM
View Questions

Biology

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
View Question
How many molecules of ATP and NADPH are required for every molecule of $$\mathrm{CO}_2$$ fixed in the Calvin cycle?
View Question
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
View Question
In the given figure, which component has thin outer walls and highly thickened inner walls?
View Question
The cofactor of the enzyme carboxypeptidase is:
View Question
The capacity to generate a whole plant from any cell of the plant is called:
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene cry IAc. Statement
View Question
Which of the following is an example of actinomorphic flower?
View Question
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special
View Question
Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers o
View Question
The lactose present in the growth medium of bacteria is transported to the cell by the action of
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
The equation of Verhulst-Pearl logistic growth is $$\frac{\mathrm{dN}}{\mathrm{dt}}=\mathrm{rN}\left[\frac{\mathrm{K}-\m
View Question
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
View Question
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
View Question
Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnos
View Question
These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat lo
View Question
Which one of the following is not a criterion for classification of fungi?
View Question
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the g
View Question
List of endangered species was released by
View Question
What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The pi
View Question
Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one
View Question
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
View Question
Formation of interfascicular cambium from fully developed parenchyma cells is an example for
View Question
Spindle fibers attach to kinetochores of chromosomes during
View Question
Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undistur
View Question
Given below are two statements: Statement I : Chromosomes become gradually visible under light microscope during leptote
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Bulliform cells are responsible for
View Question
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expec
View Question
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and
View Question
In a plant, black seed color $$(\mathrm{BB} / \mathrm{Bb})$$ is dominant over white seed color $$(\mathrm{bb})$$. In ord
View Question
Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. $$\mathrm{CO}_2$
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
The DNA present in chloroplast is:
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Which of the following statement is correct regarding the process of replication in E.coli?
View Question
Identify the correct description about the given figure :
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual repro
View Question
In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is $$100 x\left(\mathrm{kcal} \mathrm{~m}^{
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
View Question
Given below are two statements: Statement I: In $$\mathrm{C}_3$$ plants, some $$\mathrm{O}_2$$ binds to $$\mathrm{RuBisC
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Which of the following are fused in somatic hybridization involving two varieties of plants?
View Question
Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increas
View Question
Following are the stages of pathway for conduction of an action potential through the heart A. AV bundle B. Purkinje fib
View Question
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on
View Question
The flippers of the Penguins and Dolphins are the example of the
View Question
Which of the following is not a component of Fallopian tube?
View Question
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Ho
View Question
Which of the following is not a steroid hormone?
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 ph
View Question
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
View Question
Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystro
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : FS
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question
The "Ti plasmid" of Agrobacterium tumefaciens stands for
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Which of the following is not a natural/traditional contraceptive method?
View Question
Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human bo
View Question
Which of the following statements is incorrect?
View Question
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R: Assertion A : Brea
View Question
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question
Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is impermeable to wa
View Question
The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes :
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question
Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity.
View Question
Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related spe
View Question
Match List I with List II related to digestive system of cockroach. .tg {border-collapse:collapse;border-spacing:0;} .
View Question
The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C.
View Question
Choose the correct statement given below regarding juxta medullary nephron.
View Question
Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callo
View Question
Given below are two statements : Statement I : Bone marrow is the main lymphoid organ where all blood cells including ly
View Question
Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formati
View Question
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
As per ABO blood grouping system, the blood group of father is $$\mathrm{B}^{+}$$, mother is $$\mathrm{A}^{+}$$ and chil
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question
Given below are two statements: Statement I: Mitochondria and chloroplasts both double membranes bound organelles. State
View Question
Match List I with List II : .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:so
View Question

Chemistry

Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
The Henry's law constant $$(\mathrm{K}_{\mathrm{H}})$$ values of three gases $$(\mathrm{A}, \mathrm{B}, \mathrm{C})$$ in
View Question
Given below are two statements: Statement I: The boiling point of hydrides of Group 16 elements follow the order $$\math
View Question
Intramolecular hydrogen bonding is present in
View Question
Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order n-pentane >
View Question
The compound that will undergo SN1 reaction with the fastest rate is
View Question
Which one of the following alcohols reacts instantaneously with Lucas reagent?
View Question
1 gram of sodium hydroxide was treated with $$25 \mathrm{~mL}$$ of $$0.75 \mathrm{~M} \mathrm{~HCl}$$ solution, the mass
View Question
Arrange the following elements in increasing order of first ionization enthalpy: $$\mathrm{Li}, \mathrm{Be}, \mathrm{B},
View Question
The most stable carbocation among the following is :
View Question
Activation energy of any chemical reaction can be calculated if one knows the value of
View Question
Given below are two statements: Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II
View Question
Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si Choose the correct answer from t
View Question
Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Which plot of $$\ln \mathrm{k}$$ vs $$\frac{1}{\mathrm{~T}}$$ is consistent with Arrhenius equation?
View Question
The energy of an electron in the ground state $$\mathrm{(n=1)}$$ for $$\mathrm{He}^{+}$$ ion is $$\mathrm{-x} \mathrm{~J
View Question
In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline
View Question
Which reaction is NOT a redox reaction?
View Question
Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
'Spin only' magnetic moment is same for which of the following ions? A. $$\mathrm{Ti}^{3+}$$ B. $$\mathrm{Cr}^{2+}$$ C.
View Question
The highest number of helium atoms is in
View Question
Among Group 16 elements, which one does NOT show -2 oxidation state?
View Question
The $$\mathrm{E}^{\circ}$$ value for the $$\mathrm{Mn}^{3+} / \mathrm{Mn}^{2+}$$ couple is more positive than that of $$
View Question
The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen's reagent B. Schif
View Question
Identify the correct reagents that would bring about the following transformation.
View Question
In which of the following equilibria, $$\mathrm{K}_p$$ and $$\mathrm{K}_{\mathrm{c}}$$ are NOT equal?
View Question
A compound with a molecular formula of $$\mathrm{C}_6 \mathrm{H}_{14}$$ has two tertiary carbons. Its IUPAC name is :
View Question
Fehling's solution 'A' is
View Question
Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
Given below are two statements : Statement I: Both $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ and $$[\mathrm{CoF}_6]^{3-}$$
View Question
On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique
View Question
Match List I with List II. .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
For the reaction $$2 \mathrm{~A} \rightleftharpoons \mathrm{B}+\mathrm{C}, \mathrm{K}_{\mathrm{c}}=4 \times 10^{-3}$$. A
View Question
The pair of lanthanoid ions which are diamagnetic is
View Question
Given below are two statements : Statement I : $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ is a homoleptic complex whereas $
View Question
Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution fo
View Question
For the given reaction: 'P' is
View Question
The products $$\mathrm{A}$$ and $$\mathrm{B}$$ obtained in the following reactions, respectively, are $$\begin{aligned}
View Question
The rate of a reaction quadruples when temperature changes from $$27^{\circ} \mathrm{C}$$ to $$57^{\circ} \mathrm{C}$$.
View Question
During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prev
View Question
Major products A and B formed in the following reaction sequence, are
View Question
The plot of osmotic pressure (П) vs concentration $$(\mathrm{mol} \mathrm{~L}^{-1})$$ for a solution gives a straight li
View Question
Identify the correct answer.
View Question
Identify the major product C formed in the following reaction sequence : $$ \mathrm{CH}_3-\mathrm{CH}_2-\mathrm{CH}_2-\m
View Question
Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to
View Question
The work done during reversible isothermal expansion of one mole of hydrogen gas at $$25^{\circ} \mathrm{C}$$ from press
View Question
Consider the following reaction in a sealed vessel at equilibrium with concentrations of $$\mathrm{N}_2=3.0 \times 10^{-
View Question
A compound X contains $$32 \%$$ of A, $$20 \%$$ of B and remaining percentage of C. Then, the empirical formula of $$\ma
View Question

Physics

In a vernier callipers, $$(N+1)$$ divisions of vernier scale coincide with $$N$$ divisions of main scale. If $$1 \mathrm
View Question
If the monochromatic source in Young's double slit experiment is replaced by white light, then
View Question
A logic circuit provides the output $$Y$$ as per the following truth table : The expression of the output Y is :
View Question
The terminal voltage of the battery, whose emf is $$10 \mathrm{~V}$$ and internal resistance $$1 \Omega$$, when connecte
View Question
In a uniform magnetic field of $$0.049 \mathrm{~T}$$, a magnetic needle performs 20 complete oscillations in 5 seconds a
View Question
A wire of length '$$l$$' and resistance $$100 \Omega$$ is divided into 10 equal parts. The first 5 parts are connected i
View Question
A horizontal force $$10 \mathrm{~N}$$ is applied to a block $$A$$ as shown in figure. The mass of blocks $$A$$ and $$B$$
View Question
A tightly wound 100 turns coil of radius $$10 \mathrm{~cm}$$ carries a current of $$7 \mathrm{~A}$$. The magnitude of th
View Question
In an ideal transformer, the turns ratio is $$\frac{N_P}{N_S}=\frac{1}{2}$$. The ratio $$V_S: V_P$$ is equal to (the sym
View Question
The graph which shows the variation of $$\left(\frac{1}{\lambda^2}\right)$$ and its kinetic energy, $$E$$ is (where $$\l
View Question
Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and
View Question
A bob is whirled in a horizontal plane by means of a string with an initial speed of $$\omega \mathrm{~rpm}$$. The tensi
View Question
Consider the following statements A and B and identify the correct answer : A. For a solar-cell, the I-V characteristic
View Question
A thermodynamic system is taken through the cycle $$abcda$$. The work done by the gas along the path $$b c$$ is:
View Question
A thin spherical shell is charged by some source. The potential difference between the two points $$C$$ and $$P$$ (in V)
View Question
The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is $$2400 \
View Question
A particle moving with uniform speed in a circular path maintains:
View Question
If $$c$$ is the velocity of light in free space, the correct statements about photon among the following are: A. The ene
View Question
At any instant of time $$t$$, the displacement of any particle is given by $$2 t-1$$ ($$\mathrm{SI}$$ unit) under the in
View Question
A light ray enters through a right angled prism at point $$P$$ with the angle of incidence $$30^{\circ}$$ as shown in fi
View Question
In the following circuit, the equivalent capacitance between terminal A and terminal B is :
View Question
The quantities which have the same dimensions as those of solid angle are:
View Question
The maximum elongation of a steel wire of $$1 \mathrm{~m}$$ length if the elastic limit of steel and its Young's modulus
View Question
In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced curren
View Question
The mass of a planet is $$\frac{1}{10}$$th that of the earth and its diameter is half that of the earth. The acceleratio
View Question
Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol
View Question
An unpolarised light beam strikes a glass surface at Brewster's angle. Then
View Question
Match List I with List II .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:soli
View Question
Two bodies $$A$$ and $$B$$ of same mass undergo completely inelastic one dimensional collision. The body $$A$$ moves wit
View Question
$$ { }_{82}^{290} X \xrightarrow{\alpha} Y \xrightarrow{e^{+}} Z \xrightarrow{\beta^{-}} P \xrightarrow{e^{-}} Q $$ In t
View Question
If $$x=5 \sin \left(\pi t+\frac{\pi}{3}\right) \mathrm{m}$$ represents the motion of a particle executing simple harmoni
View Question
A thin flat circular disc of radius $$4.5 \mathrm{~cm}$$ is placed gently over the surface of water. If surface tension
View Question
$$ \text { The output ( } Y \text { ) of the given logic gate is similar to the output of an/a } $$
View Question
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The p
View Question
A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is $$v$$ in the d
View Question
A parallel plate capacitor is charged by connecting it to a battery through a resistor. If $$I$$ is the current in the c
View Question
The property which is not of an electromagnetic wave travelling in free space is that:
View Question
A small telescope has an objective of focal length $$140 \mathrm{~cm}$$ and an eye piece of focal length $$5.0 \mathrm{~
View Question
Two heaters $$A$$ and $$B$$ have power rating of $$1 \mathrm{~kW}$$ and $$2 \mathrm{~kW}$$, respectively. Those two are
View Question
The following graph represents the $$T$$-$$V$$ curves of an ideal gas (where $$T$$ is the temperature and $$V$$ the volu
View Question
The velocity $$(v)-$$ time $$(t)$$ plot of the motion of a body is shown below: The acceleration $$(a)-$$ time $$(t)$$
View Question
Choose the correct circuit which can achieve the bridge balance.
View Question
If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its ori
View Question
The minimum energy required to launch a satellite of mass $$m$$ from the surface of earth of mass $$M$$ and radius $$R$$
View Question
A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet th
View Question
A $$10 \mu \mathrm{F}$$ capacitor is connected to a $$210 \mathrm{~V}, 50 \mathrm{~Hz}$$ source as shown in figure. The
View Question
A metallic bar of Young's modulus, $$0.5 \times 10^{11} \mathrm{~N} \mathrm{~m}^{-2}$$ and coefficient of linear thermal
View Question
An iron bar of length $$L$$ has magnetic moment $$M$$. It is bent at the middle of its length such that the two arms mak
View Question
If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge sto
View Question
A force defined by $$F=\alpha t^2+\beta t$$ acts on a particle at a given time $$t$$. The factor which is dimensionless,
View Question
EXAM MAP
Medical
NEET
Graduate Aptitude Test in Engineering
GATE CSEGATE ECEGATE EEGATE MEGATE CEGATE PIGATE IN
Civil Services
UPSC Civil Service
Defence
NDA
CBSE
Class 12