Biology
1. Lecithin, a small molecular weight organic compound found in living tissues, is an example of: 2. How many molecules of ATP and NADPH are required for every molecule of $$\mathrm{CO}_2$$ fixed in the Calvin cycle? 3. Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of: 4. In the given figure, which component has thin outer walls and highly thickened inner walls?
5. The cofactor of the enzyme carboxypeptidase is: 6. The capacity to generate a whole plant from any cell of the plant is called: 7. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 8. Given below are two statements:
Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.
Statement 9. Which of the following is an example of actinomorphic flower? 10. The type of conservation in which the threatened species are taken out from their natural habitat and placed in special 11. Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers o 12. The lactose present in the growth medium of bacteria is transported to the cell by the action of 13. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 14. The equation of Verhulst-Pearl logistic growth is $$\frac{\mathrm{dN}}{\mathrm{dt}}=\mathrm{rN}\left[\frac{\mathrm{K}-\m 15. Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin 16. Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
17. Given below are two statements:
Statement I : Parenchyma is living but collenchyma is dead tissue.
Statement II : Gymnos 18. These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat lo 19. Which one of the following is not a criterion for classification of fungi? 20. Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the g 21. List of endangered species was released by 22. What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
A. The pi 23. Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one 24. Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of: 25. Formation of interfascicular cambium from fully developed parenchyma cells is an example for 26. Spindle fibers attach to kinetochores of chromosomes during 27. Tropical regions show greatest level of species richness because
A. Tropical latitudes have remained relatively undistur 28. Given below are two statements:
Statement I : Chromosomes become gradually visible under light microscope during leptote 29. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 30. Bulliform cells are responsible for 31. A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expec 32. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and 33. In a plant, black seed color $$(\mathrm{BB} / \mathrm{Bb})$$ is dominant over white seed color $$(\mathrm{bb})$$. In ord 34. Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. $$\mathrm{CO}_2$ 35. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 36. The DNA present in chloroplast is: 37. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 38. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 39. Which of the following statement is correct regarding the process of replication in E.coli?
40. Identify the correct description about the given figure :
41. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 42. Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual repro 43. In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is $$100 x\left(\mathrm{kcal} \mathrm{~m}^{ 44. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 45. Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate. 46. Given below are two statements:
Statement I: In $$\mathrm{C}_3$$ plants, some $$\mathrm{O}_2$$ binds to $$\mathrm{RuBisC 47. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 48. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 49. Which of the following are fused in somatic hybridization involving two varieties of plants? 50. Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increas 51. Following are the stages of pathway for conduction of an action potential through the heart
A. AV bundle
B. Purkinje fib 52. In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on 53. The flippers of the Penguins and Dolphins are the example of the 54. Which of the following is not a component of Fallopian tube? 55. Given below are some stages of human evolution.
Arrange them in correct sequence. (Past to Recent)
A. Homo habilis
B. Ho 56. Which of the following is not a steroid hormone? 57. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 58. Following are the stages of cell division :
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 ph 59. Which one of the following factors will not affect the Hardy-Weinberg equilibrium? 60. Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystro 61. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 62. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 63. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 64. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : FS 65. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 66. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 67. The "Ti plasmid" of Agrobacterium tumefaciens stands for 68. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 69. Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5' 70. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 71. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 72. Which of the following is not a natural/traditional contraceptive method? 73. Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human bo 74. Which of the following statements is incorrect? 75. Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Brea 76. Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli? 77. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 78. Consider the following statements :
A. Annelids are true coelomates
B. Poriferans are pseudocoelomates
C. Aschelminthes 79. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 80. Given below are two statements :
Statement I : In the nephron, the descending limb of loop of Henle is impermeable to wa 81. The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes :
82. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 83. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 84. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 85. Given below are two statements:
Statement I: The presence or absence of hymen is not a reliable indicator of virginity.
86. Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related spe 87. Match List I with List II related to digestive system of cockroach.
.tg {border-collapse:collapse;border-spacing:0;}
. 88. The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. 89. Choose the correct statement given below regarding juxta medullary nephron. 90. Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callo 91. Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including ly 92. Regarding catalytic cycle of an enzyme action, select the correct sequential steps :
A. Substrate enzyme complex formati 93. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
94. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 95. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 96. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 97. As per ABO blood grouping system, the blood group of father is $$\mathrm{B}^{+}$$, mother is $$\mathrm{A}^{+}$$ and chil 98. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 99. Given below are two statements:
Statement I: Mitochondria and chloroplasts both double membranes bound organelles.
State 100. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so
Chemistry
1. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 2. The Henry's law constant $$(\mathrm{K}_{\mathrm{H}})$$ values of three gases $$(\mathrm{A}, \mathrm{B}, \mathrm{C})$$ in 3. Given below are two statements:
Statement I: The boiling point of hydrides of Group 16 elements follow the order
$$\math 4. Intramolecular hydrogen bonding is present in
5. Given below are two statements:
Statement I : The boiling point of three isomeric pentanes follows the order
n-pentane > 6. The compound that will undergo SN1 reaction with the fastest rate is 7. Which one of the following alcohols reacts instantaneously with Lucas reagent? 8. 1 gram of sodium hydroxide was treated with $$25 \mathrm{~mL}$$ of $$0.75 \mathrm{~M} \mathrm{~HCl}$$ solution, the mass 9. Arrange the following elements in increasing order of first ionization enthalpy:
$$\mathrm{Li}, \mathrm{Be}, \mathrm{B}, 10. The most stable carbocation among the following is : 11. Activation energy of any chemical reaction can be calculated if one knows the value of 12. Given below are two statements:
Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II 13. Arrange the following elements in increasing order of electronegativity:
N, O, F, C, Si
Choose the correct answer from t 14. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 15. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 16. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 17. Which plot of $$\ln \mathrm{k}$$ vs $$\frac{1}{\mathrm{~T}}$$ is consistent with Arrhenius equation? 18. The energy of an electron in the ground state $$\mathrm{(n=1)}$$ for $$\mathrm{He}^{+}$$ ion is $$\mathrm{-x} \mathrm{~J 19. In which of the following processes entropy increases?
A. A liquid evaporates to vapour.
B. Temperature of a crystalline 20. Which reaction is NOT a redox reaction? 21. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 22. 'Spin only' magnetic moment is same for which of the following ions?
A. $$\mathrm{Ti}^{3+}$$
B. $$\mathrm{Cr}^{2+}$$
C. 23. The highest number of helium atoms is in 24. Among Group 16 elements, which one does NOT show -2 oxidation state? 25. The $$\mathrm{E}^{\circ}$$ value for the $$\mathrm{Mn}^{3+} / \mathrm{Mn}^{2+}$$ couple is more positive than that of $$ 26. The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen's reagent
B. Schif 27. Identify the correct reagents that would bring about the following transformation.
28. In which of the following equilibria, $$\mathrm{K}_p$$ and $$\mathrm{K}_{\mathrm{c}}$$ are NOT equal? 29. A compound with a molecular formula of $$\mathrm{C}_6 \mathrm{H}_{14}$$ has two tertiary carbons. Its IUPAC name is : 30. Fehling's solution 'A' is 31. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 32. Given below are two statements :
Statement I: Both $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ and $$[\mathrm{CoF}_6]^{3-}$$ 33. On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique 34. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 35. For the reaction $$2 \mathrm{~A} \rightleftharpoons \mathrm{B}+\mathrm{C}, \mathrm{K}_{\mathrm{c}}=4 \times 10^{-3}$$. A 36. The pair of lanthanoid ions which are diamagnetic is 37. Given below are two statements :
Statement I : $$[\mathrm{Co}(\mathrm{NH}_3)_6]^{3+}$$ is a homoleptic complex whereas $ 38. Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution fo 39. For the given reaction:
'P' is 40. The products $$\mathrm{A}$$ and $$\mathrm{B}$$ obtained in the following reactions, respectively, are
$$\begin{aligned}
41. The rate of a reaction quadruples when temperature changes from $$27^{\circ} \mathrm{C}$$ to $$57^{\circ} \mathrm{C}$$. 42. During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prev 43. Major products A and B formed in the following reaction sequence, are
44. The plot of osmotic pressure (П) vs concentration $$(\mathrm{mol} \mathrm{~L}^{-1})$$ for a solution gives a straight li 45. Identify the correct answer. 46. Identify the major product C formed in the following reaction sequence :
$$
\mathrm{CH}_3-\mathrm{CH}_2-\mathrm{CH}_2-\m 47. Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to 48. The work done during reversible isothermal expansion of one mole of hydrogen gas at $$25^{\circ} \mathrm{C}$$ from press 49. Consider the following reaction in a sealed vessel at equilibrium with concentrations of $$\mathrm{N}_2=3.0 \times 10^{- 50. A compound X contains $$32 \%$$ of A, $$20 \%$$ of B and remaining percentage of C. Then, the empirical formula of $$\ma
Physics
1. In a vernier callipers, $$(N+1)$$ divisions of vernier scale coincide with $$N$$ divisions of main scale. If $$1 \mathrm 2. If the monochromatic source in Young's double slit experiment is replaced by white light, then 3. A logic circuit provides the output $$Y$$ as per the following truth table :
The expression of the output Y is : 4. The terminal voltage of the battery, whose emf is $$10 \mathrm{~V}$$ and internal resistance $$1 \Omega$$, when connecte 5. In a uniform magnetic field of $$0.049 \mathrm{~T}$$, a magnetic needle performs 20 complete oscillations in 5 seconds a 6. A wire of length '$$l$$' and resistance $$100 \Omega$$ is divided into 10 equal parts. The first 5 parts are connected i 7. A horizontal force $$10 \mathrm{~N}$$ is applied to a block $$A$$ as shown in figure. The mass of blocks $$A$$ and $$B$$ 8. A tightly wound 100 turns coil of radius $$10 \mathrm{~cm}$$ carries a current of $$7 \mathrm{~A}$$. The magnitude of th 9. In an ideal transformer, the turns ratio is $$\frac{N_P}{N_S}=\frac{1}{2}$$. The ratio $$V_S: V_P$$ is equal to (the sym 10. The graph which shows the variation of $$\left(\frac{1}{\lambda^2}\right)$$ and its kinetic energy, $$E$$ is (where $$\l 11. Given below are two statements:
Statement I: Atoms are electrically neutral as they contain equal number of positive and 12. A bob is whirled in a horizontal plane by means of a string with an initial speed of $$\omega \mathrm{~rpm}$$. The tensi 13. Consider the following statements A and B and identify the correct answer :
A. For a solar-cell, the I-V characteristic 14. A thermodynamic system is taken through the cycle $$abcda$$. The work done by the gas along the path $$b c$$ is:
15. A thin spherical shell is charged by some source. The potential difference between the two points $$C$$ and $$P$$ (in V) 16. The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is $$2400 \ 17. A particle moving with uniform speed in a circular path maintains: 18. If $$c$$ is the velocity of light in free space, the correct statements about photon among the following are:
A. The ene 19. At any instant of time $$t$$, the displacement of any particle is given by $$2 t-1$$ ($$\mathrm{SI}$$ unit) under the in 20. A light ray enters through a right angled prism at point $$P$$ with the angle of incidence $$30^{\circ}$$ as shown in fi 21. In the following circuit, the equivalent capacitance between terminal A and terminal B is :
22. The quantities which have the same dimensions as those of solid angle are: 23. The maximum elongation of a steel wire of $$1 \mathrm{~m}$$ length if the elastic limit of steel and its Young's modulus 24.
In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced curren 25. The mass of a planet is $$\frac{1}{10}$$th that of the earth and its diameter is half that of the earth. The acceleratio 26. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 27. An unpolarised light beam strikes a glass surface at Brewster's angle. Then 28. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 29. Two bodies $$A$$ and $$B$$ of same mass undergo completely inelastic one dimensional collision. The body $$A$$ moves wit 30. $$
{ }_{82}^{290} X \xrightarrow{\alpha} Y \xrightarrow{e^{+}} Z \xrightarrow{\beta^{-}} P \xrightarrow{e^{-}} Q
$$
In t 31. If $$x=5 \sin \left(\pi t+\frac{\pi}{3}\right) \mathrm{m}$$ represents the motion of a particle executing simple harmoni 32. A thin flat circular disc of radius $$4.5 \mathrm{~cm}$$ is placed gently over the surface of water. If surface tension 33. $$
\text { The output ( } Y \text { ) of the given logic gate is similar to the output of an/a }
$$
34. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: The p 35. A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is $$v$$ in the d 36. A parallel plate capacitor is charged by connecting it to a battery through a resistor. If $$I$$ is the current in the c 37. The property which is not of an electromagnetic wave travelling in free space is that: 38. A small telescope has an objective of focal length $$140 \mathrm{~cm}$$ and an eye piece of focal length $$5.0 \mathrm{~ 39. Two heaters $$A$$ and $$B$$ have power rating of $$1 \mathrm{~kW}$$ and $$2 \mathrm{~kW}$$, respectively. Those two are 40. The following graph represents the $$T$$-$$V$$ curves of an ideal gas (where $$T$$ is the temperature and $$V$$ the volu 41. The velocity $$(v)-$$ time $$(t)$$ plot of the motion of a body is shown below:
The acceleration $$(a)-$$ time $$(t)$$ 42. Choose the correct circuit which can achieve the bridge balance. 43. If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its ori 44. The minimum energy required to launch a satellite of mass $$m$$ from the surface of earth of mass $$M$$ and radius $$R$$ 45. A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
A. hold the sheet th 46. A $$10 \mu \mathrm{F}$$ capacitor is connected to a $$210 \mathrm{~V}, 50 \mathrm{~Hz}$$ source as shown in figure. The 47. A metallic bar of Young's modulus, $$0.5 \times 10^{11} \mathrm{~N} \mathrm{~m}^{-2}$$ and coefficient of linear thermal 48. An iron bar of length $$L$$ has magnetic moment $$M$$. It is bent at the middle of its length such that the two arms mak 49. If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then
A. the charge sto 50. A force defined by $$F=\alpha t^2+\beta t$$ acts on a particle at a given time $$t$$. The factor which is dimensionless,
1
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Intramolecular hydrogen bonding is present in
A
B
C
D
HF
2
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Given below are two statements:
Statement I : The boiling point of three isomeric pentanes follows the order
n-pentane > isopentane > neopentane
Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.
In the light of the above statements, choose the most appropriate answer from the options given below:
A
Both Statement I and Statement II are correct
B
Both Statement I and Statement II are incorrect
C
Statement I is correct but Statement II is incorrect
D
Statement I is incorrect but Statement II is correct
3
NEET 2024
MCQ (Single Correct Answer)
+4
-1
The compound that will undergo SN1 reaction with the fastest rate is
A
B
C
D
4
NEET 2024
MCQ (Single Correct Answer)
+4
-1
Which one of the following alcohols reacts instantaneously with Lucas reagent?
A
$$
\mathrm{CH}_3-\mathrm{CH}_2-\mathrm{CH}_2-\mathrm{CH}_2 \mathrm{OH}
$$
B
C
D
Paper analysis
Total Questions
Biology
100
Chemistry
50
Physics
50
More papers of NEET
NEET 2024 (Re-Examination)
NEET 2024
NEET 2023 Manipur
NEET 2023
NEET 2022 Phase 2
NEET 2022 Phase 1
NEET 2021
NEET 2020 Phase 1
NEET 2019
NEET 2018
NEET 2017
NEET 2016 Phase 2
NEET 2016 Phase 1
AIPMT 2015
AIPMT 2015 Cancelled Paper
AIPMT 2014
NEET 2013 (Karnataka)
NEET 2013
AIPMT 2012 Mains
AIPMT 2012 Prelims
AIPMT 2011 Mains
AIPMT 2011 Prelims
AIPMT 2010 Mains
AIPMT 2010 Prelims
AIPMT 2009
AIPMT 2008
AIPMT 2007
AIPMT 2006
AIPMT 2005
AIPMT 2004
AIPMT 2003
AIPMT 2002
AIPMT 2001
AIPMT 2000
NEET
Papers
2014
2009
2008
2007
2006
2005
2004
2003
2002
2001
2000