1
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Change Language

Match List I with List II.

List I List II
(A) Logistic growth (I) Unlimited resource availability condition
(B) Exponential growth (II) Limited resource availability condition
(C) Expanding age pyramid (III) The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
(D) Stable age pyramid (IV) The percent individuals of pre-reproductive and reproductive age group are same

Choose the correct answer from the options given below:

A
A-II, B-III, C-I, D-IV
B
A-II, B-IV, C-I, D-III
C
A-II, B-IV, C-III, D-I
D
A-II, B-I, C-III, D-IV
2
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Change Language

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

A
3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
B
5’ ATCGATCGATCGATCGATCGATCGATCG 3’
C
3’ ATCGATCGATCGATCGATCGATCGATCG 5’
D
5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
3
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Change Language

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

A
Presence of anal styles
B
Presence of sclerites
C
Presence of anal cerci
D
Dark brown body colour and anal cerci
4
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Change Language

Which of the following statements are correct regarding skeletal muscle?

A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.

B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.

C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.

D. M line is considered as functional unit of contraction called sarcomere.

Choose the most appropriate answer from the options given below:

A
B and C only
B
A, C and D only
C
C and D only
D
A, B and C only
EXAM MAP
Medical
NEET
Graduate Aptitude Test in Engineering
GATE CSEGATE ECEGATE EEGATE MEGATE CEGATE PIGATE IN
CBSE
Class 12