NEET 2023 | NEET Year Wise Previous Years Questions

Biology

Chemistry

1. The conductivity of centimolar solution of $$\mathrm{KCl}$$ at $$25^{\circ} \mathrm{C}$$ is $$0.0210 ~\mathrm{ohm}^{-1} 2. For a certain reaction, the rate $$=\mathrm{k}[\mathrm{A}]^{2}[\mathrm{~B}]$$, when the initial concentration of A is tr 3. Identify product $$(\mathrm{A})$$ is the following reaction : 4. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Hel 5. Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shel 6. The correct order of energies of molecular orbitals of $$\mathrm{N}_{2}$$ molecule, is 7. Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol 8. The number of $$\sigma$$ bonds, $$\pi$$ bonds and lone pair of electrons in pyridine, respectively are: 9. The element expected to form largest ion to achieve the nearest noble gas configuration is 10. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : A re 11. Consider the following reaction and identify the product (P). 12. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A : In e 13. In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with 14. Identify the product in the following reaction: 15. Select the correct Statements from the following : A. Atoms of all elements are composed of two fundamental particles. B 16. Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known 17. Taking stability as the factor, which one of the following represents correct relationship? 18. Intermolecular forces are forces of attraction and repulsion between interacting particles that will include: A. dipole 19. Amongst the given options which of the following molecules/ion acts as a Lewis acid? 20. The right option for the mass of $$\mathrm{CO}_{2}$$ produced by heating $$20 \mathrm{~g}$$ of $$20 \%$$ pure limestone 21. The relation between $$\mathrm{n}_{\mathrm{m}},\left(\mathrm{n}_{\mathrm{m}}=\right.$$ the number of permissible values 22. The stability of $$\mathrm{Cu}^{2+}$$ is more than $$\mathrm{Cu}^{+}$$ salts in aqueous solution due to - 23. Which of the following reactions will NOT give primary amine as the product? 24. The given compound is an example of _________. 25. Complete the following reaction: [C] is _______. 26. Homoleptic complex from the following complexes is : 27. Consider the following reaction Identify products A and B :- 28. Which amongst the following will be most readily dehydrated under acidic conditions? 29. The equilibrium concentrations of the species in the reaction $$\mathrm{A}+\mathrm{B} \rightleftharpoons \mathrm{C}+\mat 30. Which amongst the following options is the correct relation between change in enthalpy and change in internal energy? 31. Match List I with List II: .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:sol 32. Identify the major product obtained in the following reaction: 33. Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are i 34. Consider the following compounds/species: The number of compounds/species which obey Huckel's rule is ___________. 35. Which complex compound is most stable? 36. On balancing the given redox reaction, $$\mathrm{aCr}_{2} \mathrm{O}_{7}^{2-}+\mathrm{bSO}_{3}^{2-}(\mathrm{aq})+\mathrm 37. Identify the final product [D] obtained in the following sequence of reactions.

Physics

1. In a series LCR circuit, the inductance $$L$$ is $$10 ~\mathrm{mH}$$, capacitance $$C$$ is $$1 ~\mu \mathrm{F}$$ and res 2. The magnitude and direction of the current in the following circuit is :- 3. If the galvanometer $$G$$ does not show any deflection in the circuit shown, the value of $$R$$ is given by: 4. The temperature of a gas is $$-50^{\circ} \mathrm{C}$$. To what temperature the gas should be heated so that the rms spe 5. The ratio of radius of gyration of a solid sphere of mass $$M$$ and radius $$R$$ about its own axis to the radius of gyr 6. A Carnot engine has an efficiency of $$50 \%$$ when its source is at a temperature $$327^{\circ} \mathrm{C}$$. The tempe 7. A bullet is fired from a gun at the speed of $$280 \mathrm{~ms}^{-1}$$ in the direction $$30^{\circ}$$ above the horizon 8. An electric dipole is placed at an angle of $$30^{\circ}$$ with an electric field of intensity $$2 \times 10^{5} \mathrm 9. Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electricity. State 10. The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are : 11. The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length 12. The net magnetic flux through any closed surface is : 13. The work functions of Caesium $$(\mathrm{Cs})$$, potassium $$(\mathrm{K})$$ and Sodium (Na) are $$2.14 ~\mathrm{eV}, 2.3 14. The minimum wavelength of $$X$$-rays produced by an electron accelerated through a potential difference of $$V$$ volts i 15. A $$12 \mathrm{~V}, 60 \mathrm{~W}$$ lamp is connected to the secondary of a step down transformer, whose primary is con 16. Light travels a distance $$\mathrm{x}$$ in time $$t_{1}$$ in air and $$10 \mathrm{x}$$ in time $$t_{2}$$ in another dens 17. A metal wire has mass $$(0.4 \pm 0.002) ~\mathrm{g}$$, radius $$(0.3 \pm 0.001) ~\mathrm{mm}$$ and length $$(5 \pm 0.02) 18. For Young's double slit experiment, two statements are given below : Statement I : If screen is moved away from the plan 19. The equivalent capacitance of the system shown in the following circuit is: 20. Resistance of a carbon resistor determined from colour codes is $$(22000 \pm 5 \%) \Omega$$. The colour of third band mu 21. An ac source is connected to a capacitor C. Due to decrease in its operating frequency 22. A vehicle travels half the distance with speed $$v$$ and the remaining distance with speed $$2 v$$. Its average speed is 23. The amount of energy required to form a soap bubble of radius $$2 \mathrm{~cm}$$ from a soap solution is nearly: (surfac 24. The venturi-meter works on : 25. In hydrogen spectrum, the shortest wavelength in the Balmer series is $$\lambda$$. The shortest wavelength in the Bracke 26. The potential energy of a long spring when stretched by $$2 \mathrm{~cm}$$ is U. If the spring is stretched by $$8 \math 27. A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load res 28. The magnetic energy stored in an inductor of inductance $$4 ~\mu \mathrm{H}$$ carrying a current of $$2 \mathrm{~A}$$ is 29. If $$\oint_\limits{s} \vec{E} \cdot \overrightarrow{d S}=0$$ over a surface, then: 30. A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force th 31. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight $$W$$ attached at its free end. The l 32. The angular acceleration of a body, moving along the circumference of a circle, is : 33. In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a freq 34. Two bodies of mass $$m$$ and $$9 m$$ are placed at a distance $$R$$. The gravitational potential on the line joining the 35. In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are t 36. Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The 37. A satellite is orbiting just above the surface of the earth with period $$T$$. If $$d$$ is the density of the earth and 38. The $$x$$ - $$t$$ graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the 39. For the following logic circuit, the truth table is: 40. A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards wit 41. Two thin lenses are of same focal lengths $$(f)$$, but one is convex and the other one is concave. When they are placed 42. A wire carrying a current $$I$$ along the positive $$\mathrm{x}$$-axis has length $$L$$. It is kept in a magnetic field 43. A bullet from a gun is fired on a rectangular wooden block with velocity $$u$$. When bullet travels $$24 \mathrm{~cm}$$ 44. The resistance of platinum wire at $$0^{\circ} \mathrm{C}$$ is $$2 ~\Omega$$ and $$6.8 ~\Omega$$ at $$80^{\circ} \mathrm 45. An electric dipole is placed as shown in the figure. The electric potential (in 102 V) at point P due to the dipole is 46. 10 resistors, each of resistance $$\mathrm{R}$$ are connected in series to a battery of emf $$E$$ and negligible interna 47. A very long conducting wire is bent in a semi-circular shape from $$A$$ to $$B$$ as shown in figure. The magnetic field 48. The radius of inner most orbit of hydrogen atom is $$5.3 \times 10^{-11} \mathrm{~m}$$. What is the radius of third allo 49. The net impedance of circuit (as shown in figure) will be :

NEET 2023

MCQ (Single Correct Answer)

-1

Given below are two statements:

Statement I : During G₀ phase of cell cycle, the cell is metabolically inactive.

Statement II : The centrosome undergoes duplication during S phase of interphase.

In the light of the above statements, choose the most appropriate answer from the options given below:

Both Statement I and Statement II are incorrect.

Statement I is correct but Statement II is incorrect.

Statement I is incorrect but Statement II is correct.

Both Statement I and Statement II are correct.

NEET 2023

MCQ (Single Correct Answer)

-1

Select the correct statements with reference to chordates.

A. Presence of a mid-dorsal, solid and double nerve cord.

B. Presence of closed circulatory system.

C. Presence of paired pharyngeal gill slits.

D. Presence of dorsal heart

E. Triploblastic pseudocoelomate animals.

Choose the correct answer from the options given below:

B and C only

B, D and E only

C, D and E only

A, C and D only

NEET 2023

MCQ (Single Correct Answer)

-1

Match List I with List II.

	List I		List II
(A)	Logistic growth	(I)	Unlimited resource availability condition
(B)	Exponential growth	(II)	Limited resource availability condition
(C)	Expanding age pyramid	(III)	The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
(D)	Stable age pyramid	(IV)	The percent individuals of pre-reproductive and reproductive age group are same

Choose the correct answer from the options given below:

A-II, B-III, C-I, D-IV

A-II, B-IV, C-I, D-III

A-II, B-IV, C-III, D-I

A-II, B-I, C-III, D-IV

NEET 2023

MCQ (Single Correct Answer)

-1

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’

5’ ATCGATCGATCGATCGATCGATCGATCG 3’

3’ ATCGATCGATCGATCGATCGATCGATCG 5’

5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’

PREVIOUS NEXT