Biology
1. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species? 2. Identify the pair of heterosporous pteridophytes among the following : 3. Frequency of recombination between gene pairs on same chromosome as a measure of the distance
between genes to map thei 4. What is the function of tassels in the corn cob? 5. Identify the correct statements :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes 6. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : La 7. The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis? 8. Which of the following stages of meiosis involves division of centromere? 9. During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out 10. Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the
characteristics specif 11. Large, colourful, fragrant flowers with nectar are seen in 12. Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period,
that leads ea 13. Among eukaryotes, replication of DNA takes place in : 14. How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle? 15. In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used. 16. Unequivocal proof that DNA is the genetic material was first proposed by 17. In the equation GPP $$-$$ R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is __________ 18. What is the role of RNA polymerase III in the process of transcription in Eukaryotes? 19. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are : 20. The phenomenon of pleiotropism refers to 21. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : AT 22. Cellulose does not form blue colour with Iodine because 23. Which hormone promotes internode/petiole elongation in deep water rice? 24. Expressed Sequence Tags (ESTs) refers to 25. Upon exposure to UV radiation, DNA stained with ethidium bromide will show 26. The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year 27. The reaction centre in PS II has an absorption maxima at 28. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:
Assertion A : The first 29. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This
phenomenon may be 30. Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position o 31. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 32. Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Lang 33. Given below are two statements:
Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related 34. How many different proteins does the ribosome consist of? 35. Which of the following combinations is required for chemiosmosis? 36. Which one of the following statements is NOT correct? 37. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 38. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct
sequence.
A. Insertion 39. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 40. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :
Assertion A : In gymno 41. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A 42. Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of 43. Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino ac 44. Radial symmetry is NOT found in adults of phylum ______. 45. Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical ch 46. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Neph 47. Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic reticulum
C 48. Broad palm with single palm crease is visible in a person suffering from- 49. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 50. Which one of the following common sexually transmitted diseases is completely curable when detected early and treated pr 51. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endom 52. Which of the following is not a cloning vector? 53. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 54. Given below are two statements:
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense re 55. Which of the following functions is carried out by cytoskeleton in a cell? 56. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 57. Which one of the following symbols represents mating between relatives in human pedigree analysis? 58. Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its
early treatmen 59. Given below are two statements :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state wher 60. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 61. Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as 62. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses? 63. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 64. Vital capacity of lung is ________. 65. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation. 66. Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A : Amniocen 67. Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and s 68. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 69. Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively cha 70. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 71. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 72. Which of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secre 73. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 74. Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split a 75. In cockroach, excretion is brought about by -
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collateria 76. Given below are two statements:
Statement I : During G0 phase of cell cycle, the cell is metabolically inactive.
Stateme 77. Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. 78. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 79. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 80. Which of the following is characteristic feature of cockroach regarding sexual dimorphism? 81. Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagen 82. The unique mammalian characteristics are : 83. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure,
rage, fear e 84. Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmorecepto 85. Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B.
Chemistry
1. The conductivity of centimolar solution of $$\mathrm{KCl}$$ at $$25^{\circ} \mathrm{C}$$ is $$0.0210 ~\mathrm{ohm}^{-1} 2. For a certain reaction, the rate $$=\mathrm{k}[\mathrm{A}]^{2}[\mathrm{~B}]$$, when the initial concentration of A is tr 3. Identify product $$(\mathrm{A})$$ is the following reaction :
4. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Hel 5. Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shel 6. The correct order of energies of molecular orbitals of $$\mathrm{N}_{2}$$ molecule, is 7. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 8. The number of $$\sigma$$ bonds, $$\pi$$ bonds and lone pair of electrons in pyridine, respectively are: 9. The element expected to form largest ion to achieve the nearest noble gas configuration is 10. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : A re 11. Consider the following reaction and identify the product (P).
12. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : In e 13. In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with 14. Identify the product in the following reaction:
15. Select the correct Statements from the following :
A. Atoms of all elements are composed of two fundamental particles.
B 16. Given below are two statements:
Statement I : A unit formed by the attachment of a base to 1' position of sugar is known 17. Taking stability as the factor, which one of the following represents correct relationship? 18. Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:
A. dipole 19. Amongst the given options which of the following molecules/ion acts as a Lewis acid? 20. The right option for the mass of $$\mathrm{CO}_{2}$$ produced by heating $$20 \mathrm{~g}$$ of $$20 \%$$ pure limestone 21. The relation between $$\mathrm{n}_{\mathrm{m}},\left(\mathrm{n}_{\mathrm{m}}=\right.$$ the number of permissible values 22. The stability of $$\mathrm{Cu}^{2+}$$ is more than $$\mathrm{Cu}^{+}$$ salts in aqueous solution due to - 23. Which of the following reactions will NOT give primary amine as the product? 24. The given compound
is an example of _________. 25. Complete the following reaction:
[C] is _______. 26. Homoleptic complex from the following complexes is : 27. Consider the following reaction
Identify products A and B :- 28. Which amongst the following will be most readily dehydrated under acidic conditions? 29. The equilibrium concentrations of the species in the reaction $$\mathrm{A}+\mathrm{B} \rightleftharpoons \mathrm{C}+\mat 30. Which amongst the following options is the correct relation between change in enthalpy and change in internal energy? 31. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 32. Identify the major product obtained in the following reaction:
33. Which of the following statements are INCORRECT?
A. All the transition metals except scandium form MO oxides which are i 34. Consider the following compounds/species:
The number of compounds/species which obey Huckel's rule is ___________. 35. Which complex compound is most stable? 36. On balancing the given redox reaction,
$$\mathrm{aCr}_{2} \mathrm{O}_{7}^{2-}+\mathrm{bSO}_{3}^{2-}(\mathrm{aq})+\mathrm 37. Identify the final product [D] obtained in the following sequence of reactions.
Physics
1. In a series LCR circuit, the inductance $$L$$ is $$10 ~\mathrm{mH}$$, capacitance $$C$$ is $$1 ~\mu \mathrm{F}$$ and res 2. The magnitude and direction of the current in the following circuit is :-
3. If the galvanometer $$G$$ does not show any deflection in the circuit shown, the value of $$R$$ is given by:
4. The temperature of a gas is $$-50^{\circ} \mathrm{C}$$. To what temperature the gas should be heated so that the rms spe 5. The ratio of radius of gyration of a solid sphere of mass $$M$$ and radius $$R$$ about its own axis to the radius of gyr 6. A Carnot engine has an efficiency of $$50 \%$$ when its source is at a temperature $$327^{\circ} \mathrm{C}$$. The tempe 7. A bullet is fired from a gun at the speed of $$280 \mathrm{~ms}^{-1}$$ in the direction $$30^{\circ}$$ above the horizon 8. An electric dipole is placed at an angle of $$30^{\circ}$$ with an electric field of intensity $$2 \times 10^{5} \mathrm 9. Given below are two statements:
Statement I : Photovoltaic devices can convert optical radiation into electricity.
State 10. The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are : 11. The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length 12. The net magnetic flux through any closed surface is : 13. The work functions of Caesium $$(\mathrm{Cs})$$, potassium $$(\mathrm{K})$$ and Sodium (Na) are $$2.14 ~\mathrm{eV}, 2.3 14. The minimum wavelength of $$X$$-rays produced by an electron accelerated through a potential difference of $$V$$ volts i 15. A $$12 \mathrm{~V}, 60 \mathrm{~W}$$ lamp is connected to the secondary of a step down transformer, whose primary is con 16. Light travels a distance $$\mathrm{x}$$ in time $$t_{1}$$ in air and $$10 \mathrm{x}$$ in time $$t_{2}$$ in another dens 17. A metal wire has mass $$(0.4 \pm 0.002) ~\mathrm{g}$$, radius $$(0.3 \pm 0.001) ~\mathrm{mm}$$ and length $$(5 \pm 0.02) 18. For Young's double slit experiment, two statements are given below :
Statement I : If screen is moved away from the plan 19. The equivalent capacitance of the system shown in the following circuit is:
20. Resistance of a carbon resistor determined from colour codes is $$(22000 \pm 5 \%) \Omega$$. The colour of third band mu 21. An ac source is connected to a capacitor C. Due to decrease in its operating frequency 22. A vehicle travels half the distance with speed $$v$$ and the remaining distance with speed $$2 v$$. Its average speed is 23. The amount of energy required to form a soap bubble of radius $$2 \mathrm{~cm}$$ from a soap solution is nearly: (surfac 24. The venturi-meter works on : 25. In hydrogen spectrum, the shortest wavelength in the Balmer series is $$\lambda$$. The shortest wavelength in the Bracke 26. The potential energy of a long spring when stretched by $$2 \mathrm{~cm}$$ is U. If the spring is stretched by $$8 \math 27. A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load res 28. The magnetic energy stored in an inductor of inductance $$4 ~\mu \mathrm{H}$$ carrying a current of $$2 \mathrm{~A}$$ is 29. If $$\oint_\limits{s} \vec{E} \cdot \overrightarrow{d S}=0$$ over a surface, then: 30. A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force th 31. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight $$W$$ attached at its free end. The l 32. The angular acceleration of a body, moving along the circumference of a circle, is : 33. In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a freq 34. Two bodies of mass $$m$$ and $$9 m$$ are placed at a distance $$R$$. The gravitational potential on the line joining the 35. In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are t 36. Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The 37. A satellite is orbiting just above the surface of the earth with period $$T$$. If $$d$$ is the density of the earth and 38. The $$x$$ - $$t$$ graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the 39. For the following logic circuit, the truth table is:
40. A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards wit 41. Two thin lenses are of same focal lengths $$(f)$$, but one is convex and the other one is concave. When they are placed 42. A wire carrying a current $$I$$ along the positive $$\mathrm{x}$$-axis has length $$L$$. It is kept in a magnetic field 43. A bullet from a gun is fired on a rectangular wooden block with velocity $$u$$. When bullet travels $$24 \mathrm{~cm}$$ 44. The resistance of platinum wire at $$0^{\circ} \mathrm{C}$$ is $$2 ~\Omega$$ and $$6.8 ~\Omega$$ at $$80^{\circ} \mathrm 45. An electric dipole is placed as shown in the figure.
The electric potential (in 102 V) at point P due to the dipole is 46. 10 resistors, each of resistance $$\mathrm{R}$$ are connected in series to a battery of emf $$E$$ and negligible interna 47. A very long conducting wire is bent in a semi-circular shape from $$A$$ to $$B$$ as shown in figure. The magnetic field 48. The radius of inner most orbit of hydrogen atom is $$5.3 \times 10^{-11} \mathrm{~m}$$. What is the radius of third allo 49. The net impedance of circuit (as shown in figure) will be :
1
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gill slits.
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:
A
B and C only
B
B, D and E only
C
C, D and E only
D
A, C and D only
2
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Logistic growth | (I) | Unlimited resource availability condition |
| (B) | Exponential growth | (II) | Limited resource availability condition |
| (C) | Expanding age pyramid | (III) | The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| (D) | Stable age pyramid | (IV) | The percent individuals of pre-reproductive and reproductive age group are same |
Choose the correct answer from the options given below:
A
A-II, B-III, C-I, D-IV
B
A-II, B-IV, C-I, D-III
C
A-II, B-IV, C-III, D-I
D
A-II, B-I, C-III, D-IV
3
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
A
3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
B
5’ ATCGATCGATCGATCGATCGATCGATCG 3’
C
3’ ATCGATCGATCGATCGATCGATCGATCG 5’
D
5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
4
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
A
Presence of anal styles
B
Presence of sclerites
C
Presence of anal cerci
D
Dark brown body colour and anal cerci
Paper Analysis
Total Questions
Biology 85
Chemistry 37
Physics 49
More Papers of NEET
NEET 2026 NEET 2025 NEET 2024 (Re-Examination) NEET 2024 NEET 2023 Manipur NEET 2023 NEET 2022 Phase 2 NEET 2022 Phase 1 NEET 2021 NEET 2020 Phase 1 NEET 2019 NEET 2018 NEET 2017 NEET 2016 Phase 2 NEET 2016 Phase 1 AIPMT 2015 AIPMT 2015 Cancelled Paper AIPMT 2014 NEET 2013 (Karnataka) NEET 2013 AIPMT 2012 Mains AIPMT 2012 Prelims AIPMT 2011 Mains AIPMT 2011 Prelims AIPMT 2010 Mains AIPMT 2010 Prelims AIPMT 2009 AIPMT 2008 AIPMT 2007 AIPMT 2006 AIPMT 2005 AIPMT 2004 AIPMT 2003 AIPMT 2002 AIPMT 2001 AIPMT 2000
NEET Papers
All year-wise previous year question papers
2014
2009
2008
2007
2006
2005
2004
2003
2002
2001
2000