Biology
1. Movement and accumulation of ions across a membrane against their concentration gradient can be
explained by 2. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species? 3. Identify the pair of heterosporous pteridophytes among the following : 4. Frequency of recombination between gene pairs on same chromosome as a measure of the distance
between genes to map thei 5. What is the function of tassels in the corn cob? 6. Identify the correct statements :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes 7. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : La 8. The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis? 9. Which of the following stages of meiosis involves division of centromere? 10. During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out 11. Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the
characteristics specif 12. Large, colourful, fragrant flowers with nectar are seen in 13. Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period,
that leads ea 14. Axile placentation is observed in 15. Among eukaryotes, replication of DNA takes place in : 16. How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle? 17. In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used. 18. The thickness of ozone in a column of air in the atmosphere is measured in terms of : 19. Unequivocal proof that DNA is the genetic material was first proposed by 20. In the equation GPP $$-$$ R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is __________ 21. What is the role of RNA polymerase III in the process of transcription in Eukaryotes? 22. Which micronutrient is required for splitting of water molecule during photosynthesis? 23. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are : 24. The phenomenon of pleiotropism refers to 25. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : AT 26. Cellulose does not form blue colour with Iodine because 27. Which hormone promotes internode/petiole elongation in deep water rice? 28. Expressed Sequence Tags (ESTs) refers to 29. Given below are two statements :
Statement I : The forces generated transpiration can lift a xylem-sized column of water 30. Upon exposure to UV radiation, DNA stained with ethidium bromide will show 31. The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year 32. The reaction centre in PS II has an absorption maxima at 33. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:
Assertion A : The first 34. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This
phenomenon may be 35. Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position o 36. Identify the correct statements:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark for 37. Match List I with List II :
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:so 38. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 39. Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Lang 40. Given below are two statements:
Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related 41. How many different proteins does the ribosome consist of? 42. Which of the following combinations is required for chemiosmosis? 43. Which one of the following statements is NOT correct? 44. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 45. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct
sequence.
A. Insertion 46. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 47. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 48. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :
Assertion A : In gymno 49. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A 50. Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of 51. Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino ac 52. Radial symmetry is NOT found in adults of phylum ______. 53. Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical ch 54. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Neph 55. Match List I with List II with respect to human eye.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-co 56. Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic reticulum
C 57. Broad palm with single palm crease is visible in a person suffering from- 58. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 59. Which one of the following common sexually transmitted diseases is completely curable when detected early and treated pr 60. Match List I with List II
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:soli 61. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endom 62. Which of the following is not a cloning vector? 63. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 64. Given below are two statements:
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense re 65. Which of the following functions is carried out by cytoskeleton in a cell? 66. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 67. Which of the following statements is correct? 68. Which one of the following symbols represents mating between relatives in human pedigree analysis? 69. Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by 70. Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its
early treatmen 71. Given below are two statements :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state wher 72. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 73. Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as 74. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses? 75. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 76. Vital capacity of lung is ________. 77. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation. 78. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 79. Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A : Amniocen 80. Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and s 81. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 82. Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant.
Stat 83. Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively cha 84. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 85. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 86. Which of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secre 87. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 88. Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split a 89. In cockroach, excretion is brought about by -
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collateria 90. Given below are two statements:
Statement I : During G0 phase of cell cycle, the cell is metabolically inactive.
Stateme 91. Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. 92. Match List I with List II.
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 93. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 94. Which of the following is characteristic feature of cockroach regarding sexual dimorphism? 95. Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagen 96. The unique mammalian characteristics are : 97. Which one of the following is NOT an advantage of inbreeding? 98. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure,
rage, fear e 99. Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmorecepto 100. Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B.
Chemistry
1. Given below are two statements : one is labelled as
Assertion $$\mathbf{A}$$ and the other is labelled as Reason $$\math 2. The conductivity of centimolar solution of $$\mathrm{KCl}$$ at $$25^{\circ} \mathrm{C}$$ is $$0.0210 ~\mathrm{ohm}^{-1} 3. For a certain reaction, the rate $$=\mathrm{k}[\mathrm{A}]^{2}[\mathrm{~B}]$$, when the initial concentration of A is tr 4. Identify product $$(\mathrm{A})$$ is the following reaction :
5. Which one is an example of heterogenous catalysis? 6. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Hel 7. Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shel 8. The correct order of energies of molecular orbitals of $$\mathrm{N}_{2}$$ molecule, is 9. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 10. The number of $$\sigma$$ bonds, $$\pi$$ bonds and lone pair of electrons in pyridine, respectively are: 11. The element expected to form largest ion to achieve the nearest noble gas configuration is 12. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : A re 13. Consider the following reaction and identify the product (P).
14. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : In e 15. Which amongst the following options is correct graphical representation of Boyle's law? 16. In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with 17. Identify the product in the following reaction:
18. Select the correct Statements from the following :
A. Atoms of all elements are composed of two fundamental particles.
B 19. A compound is formed by two elements A and B. The elements B forms cubic close packed structure and atoms of A occupy $$ 20. Given below are two statements:
Statement I : A unit formed by the attachment of a base to 1' position of sugar is known 21. Which amongst the following molecules on polymerization produces neoprene? 22. Taking stability as the factor, which one of the following represents correct relationship? 23. Some tranquilizers are listed below. Which one from the following belongs to barbiturates? 24. Which of the following statements are NOT correct?
A. Hydrogen is used to reduce heavy metal oxides to metals.
B. Heavy 25. Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:
A. dipole 26. Amongst the given options which of the following molecules/ion acts as a Lewis acid? 27. The right option for the mass of $$\mathrm{CO}_{2}$$ produced by heating $$20 \mathrm{~g}$$ of $$20 \%$$ pure limestone 28. The relation between $$\mathrm{n}_{\mathrm{m}},\left(\mathrm{n}_{\mathrm{m}}=\right.$$ the number of permissible values 29. The stability of $$\mathrm{Cu}^{2+}$$ is more than $$\mathrm{Cu}^{+}$$ salts in aqueous solution due to - 30. Which one of the following statements is correct? 31. Which of the following reactions will NOT give primary amine as the product? 32. The given compound
is an example of _________. 33. Complete the following reaction:
[C] is _______. 34. Homoleptic complex from the following complexes is : 35. Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in 36. Consider the following reaction
Identify products A and B :- 37. Which amongst the following will be most readily dehydrated under acidic conditions? 38. The equilibrium concentrations of the species in the reaction $$\mathrm{A}+\mathrm{B} \rightleftharpoons \mathrm{C}+\mat 39. Given below are two statements:
Statement I : The nutrient deficient water bodies lead to eutrophication.
Statement II : 40. Which amongst the following options is the correct relation between change in enthalpy and change in internal energy? 41. Match List I with List II:
.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:sol 42. Identify the major product obtained in the following reaction:
43. Pumice stone is an example of - 44. The reaction that does NOT take place in blast
furnace between 900 K to 1500 K temperature
range during extraction of 45. Which of the following statements are INCORRECT?
A. All the transition metals except scandium form MO oxides which are i 46. Consider the following compounds/species:
The number of compounds/species which obey Huckel's rule is ___________. 47. What fraction of one edge centred octahedral void lies
in one unit cell of fcc? 48. Which complex compound is most stable? 49. On balancing the given redox reaction,
$$\mathrm{aCr}_{2} \mathrm{O}_{7}^{2-}+\mathrm{bSO}_{3}^{2-}(\mathrm{aq})+\mathrm 50. Identify the final product [D] obtained in the following sequence of reactions.
Physics
1. In a series LCR circuit, the inductance $$L$$ is $$10 ~\mathrm{mH}$$, capacitance $$C$$ is $$1 ~\mu \mathrm{F}$$ and res 2. The magnitude and direction of the current in the following circuit is :-
3. If the galvanometer $$G$$ does not show any deflection in the circuit shown, the value of $$R$$ is given by:
4. The temperature of a gas is $$-50^{\circ} \mathrm{C}$$. To what temperature the gas should be heated so that the rms spe 5. The ratio of radius of gyration of a solid sphere of mass $$M$$ and radius $$R$$ about its own axis to the radius of gyr 6. A Carnot engine has an efficiency of $$50 \%$$ when its source is at a temperature $$327^{\circ} \mathrm{C}$$. The tempe 7. A bullet is fired from a gun at the speed of $$280 \mathrm{~ms}^{-1}$$ in the direction $$30^{\circ}$$ above the horizon 8. An electric dipole is placed at an angle of $$30^{\circ}$$ with an electric field of intensity $$2 \times 10^{5} \mathrm 9. Given below are two statements:
Statement I : Photovoltaic devices can convert optical radiation into electricity.
State 10. The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are : 11. The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length 12. The net magnetic flux through any closed surface is : 13. The work functions of Caesium $$(\mathrm{Cs})$$, potassium $$(\mathrm{K})$$ and Sodium (Na) are $$2.14 ~\mathrm{eV}, 2.3 14. The minimum wavelength of $$X$$-rays produced by an electron accelerated through a potential difference of $$V$$ volts i 15. A $$12 \mathrm{~V}, 60 \mathrm{~W}$$ lamp is connected to the secondary of a step down transformer, whose primary is con 16. Light travels a distance $$\mathrm{x}$$ in time $$t_{1}$$ in air and $$10 \mathrm{x}$$ in time $$t_{2}$$ in another dens 17. A metal wire has mass $$(0.4 \pm 0.002) ~\mathrm{g}$$, radius $$(0.3 \pm 0.001) ~\mathrm{mm}$$ and length $$(5 \pm 0.02) 18. For Young's double slit experiment, two statements are given below :
Statement I : If screen is moved away from the plan 19. The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to $$\left(\fr 20. The equivalent capacitance of the system shown in the following circuit is:
21. Resistance of a carbon resistor determined from colour codes is $$(22000 \pm 5 \%) \Omega$$. The colour of third band mu 22. An ac source is connected to a capacitor C. Due to decrease in its operating frequency 23. A vehicle travels half the distance with speed $$v$$ and the remaining distance with speed $$2 v$$. Its average speed is 24. The amount of energy required to form a soap bubble of radius $$2 \mathrm{~cm}$$ from a soap solution is nearly: (surfac 25. The venturi-meter works on : 26. In hydrogen spectrum, the shortest wavelength in the Balmer series is $$\lambda$$. The shortest wavelength in the Bracke 27. The potential energy of a long spring when stretched by $$2 \mathrm{~cm}$$ is U. If the spring is stretched by $$8 \math 28. A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load res 29. The magnetic energy stored in an inductor of inductance $$4 ~\mu \mathrm{H}$$ carrying a current of $$2 \mathrm{~A}$$ is 30. If $$\oint_\limits{s} \vec{E} \cdot \overrightarrow{d S}=0$$ over a surface, then: 31. A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force th 32. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight $$W$$ attached at its free end. The l 33. The angular acceleration of a body, moving along the circumference of a circle, is : 34. In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a freq 35. Two bodies of mass $$m$$ and $$9 m$$ are placed at a distance $$R$$. The gravitational potential on the line joining the 36. In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are t 37. Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The 38. A satellite is orbiting just above the surface of the earth with period $$T$$. If $$d$$ is the density of the earth and 39. The $$x$$ - $$t$$ graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the 40. For the following logic circuit, the truth table is:
41. A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards wit 42. Two thin lenses are of same focal lengths $$(f)$$, but one is convex and the other one is concave. When they are placed 43. A wire carrying a current $$I$$ along the positive $$\mathrm{x}$$-axis has length $$L$$. It is kept in a magnetic field 44. A bullet from a gun is fired on a rectangular wooden block with velocity $$u$$. When bullet travels $$24 \mathrm{~cm}$$ 45. The resistance of platinum wire at $$0^{\circ} \mathrm{C}$$ is $$2 ~\Omega$$ and $$6.8 ~\Omega$$ at $$80^{\circ} \mathrm 46. An electric dipole is placed as shown in the figure.
The electric potential (in 102 V) at point P due to the dipole is 47. 10 resistors, each of resistance $$\mathrm{R}$$ are connected in series to a battery of emf $$E$$ and negligible interna 48. A very long conducting wire is bent in a semi-circular shape from $$A$$ to $$B$$ as shown in figure. The magnetic field 49. The radius of inner most orbit of hydrogen atom is $$5.3 \times 10^{-11} \mathrm{~m}$$. What is the radius of third allo 50. The net impedance of circuit (as shown in figure) will be :
1
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gill slits.
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:
A
B and C only
B
B, D and E only
C
C, D and E only
D
A, C and D only
2
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Match List I with List II.
List I | List II | ||
---|---|---|---|
(A) | Logistic growth | (I) | Unlimited resource availability condition |
(B) | Exponential growth | (II) | Limited resource availability condition |
(C) | Expanding age pyramid | (III) | The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
(D) | Stable age pyramid | (IV) | The percent individuals of pre-reproductive and reproductive age group are same |
Choose the correct answer from the options given below:
A
A-II, B-III, C-I, D-IV
B
A-II, B-IV, C-I, D-III
C
A-II, B-IV, C-III, D-I
D
A-II, B-I, C-III, D-IV
3
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
A
3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
B
5’ ATCGATCGATCGATCGATCGATCGATCG 3’
C
3’ ATCGATCGATCGATCGATCGATCGATCG 5’
D
5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
4
NEET 2023
MCQ (Single Correct Answer)
+4
-1
Out of Syllabus
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
A
Presence of anal styles
B
Presence of sclerites
C
Presence of anal cerci
D
Dark brown body colour and anal cerci
Paper analysis
Total Questions
Biology
100
Chemistry
50
Physics
50
More papers of NEET
NEET 2023 Manipur
NEET 2023
NEET 2022 Phase 2
NEET 2022 Phase 1
NEET 2021
NEET 2020 Phase 1
NEET 2019
NEET 2018
NEET 2017
NEET 2016 Phase 2
NEET 2016 Phase 1
AIPMT 2015
AIPMT 2015 Cancelled Paper
AIPMT 2014
NEET 2013 (Karnataka)
NEET 2013
AIPMT 2012 Mains
AIPMT 2012 Prelims
AIPMT 2011 Mains
AIPMT 2011 Prelims
AIPMT 2010 Mains
AIPMT 2010 Prelims
AIPMT 2009
AIPMT 2008
AIPMT 2007
AIPMT 2006
AIPMT 2005
AIPMT 2004
AIPMT 2003
AIPMT 2002
AIPMT 2001
AIPMT 2000
NEET
Papers
2020
2014
2009
2008
2007
2006
2005
2004
2003
2002
2001
2000